Abstract Objective To investigate the the XPA gene 5 ‘ non-coding region of the transcription initiation codon ATG upstream 4 A23G and a 228 codon G709A single nucleotide polymorphisms (Single nucleotide polymorphism, SNP) and Hebei Province esophageal, cardia cancer high incidence – Cixian, and SheXian crowd of esophageal squamous cell carcinoma (Esophageal squamous cell carcinoma of genetic susceptibility to ESCC) and gastric cardia adenocarcinoma (Gastric cardiac adenocarcinoma, GCA).  polymerase chain reaction and restriction fragment length polymorphism (PCR  RFLP) analysis was used to detect the 327 ESCC patients, 253 GCA patients and 612 healthy controls XPA A23G and G709A SNP genotype. Results XPA gene A23G allele and genotype frequencies between ESCC and healthy controls, a significant difference in the overall distribution. Compared with the A / A genotype, A / G+ G / G genotype can significantly reduce the risk of developing ESCC. Stratified analysis showed that this protective effect is particularly evident in the population of the non-smoking group and the smoking group. This protective effect is also evident in the UGIC family history negative crowd. 0.05)。">A23G allele and genotype frequencies between GCA and healthy controls, the overall distribution was no significant difference (P> 0.05). Compared with the A / A genotype, A / G+ G / G genotype can significantly reduce the risk of developing GCA. Stratified analysis showed that, in the non-smoking group, the genotype frequency distribution between GCA patients and healthy controls significant difference (P <0.05). Compared with the A / A genotype, A / G+ G / G genotype can significantly reduce the non-smokers risk of developing GCA. Conclusion XPA gene A23G genotypes containing the mutant allele (G) (A / G + G / G) may affect Hebei Province esophageal cardia high incidence – of Cixian and Shexian crowd ESCC incidence risk factors one.

Key words esophageal squamous cell carcinoma of the cardia adenocarcinoma XPA gene polymorphism

    The body’s DNA repair system plays an important role to maintain the integrity of the genome function, and damage repair due to cancer-causing factors [1]. Low DNA repair capacity (DNA repair capacity, DRC) and increased risk of cancer related [2]. Nucleotide excision repair (Nucleotide eacision repair, NER) is the main human and most flexible DNA damage repair pathways.

    XPA is an evolutionary conserved DNA repair enzyme in nucleotide excision repair pathway, and the RPA [3], the XPC, the TFIIH, XPG, of ERCC1 the  XPF composite body and DNA polymerase together to complete the repair of DNA [4]. XPA polymorphism may affect protein function and then change the the individuals DNA damage repair capacity. XPA polymorphism and lung cancer research has been reported [5,6]. XPA polymorphism and esophageal and gastric cardia relationship has not been reported.

    In this study, polymerase chain reaction  restriction fragment length polymorphism (Polymerase chain reaction  restriction fragment length polymorphism, PCR  RFLP) analysis methods to explore the XPA gene polymorphism and Hebei Province esophageal and gastric cardia high incidence – magnetic County and Shexian crowd of esophageal squamous cell carcinoma (ESCC) and gastric cardia adenocarcinoma (GCA) Genetic susceptibility.

    1 Materials and Methods

    1.1 The object of study

    327 esophageal squamous cell carcinoma (Esophageal squamous cell carcinoma ESCC) patients, 253 cardia adenocarcinoma (Gastric cardiac adenocarcinoma, GCA) patients were from Hebei Province, esophageal and gastric cardia high incidence Cixian and Shexian 612 health control for the examination of the same time in the same region of the normal population, and I am informed consent, the investigation by a special registrar All of the subjects of gender, age, smoking history, family history of cancer and upper gastrointestinal. Currently smoking or who smoked more than five a day and last for two years or two years or more is defined as smoking individuals. The family has one or more first-degree relatives, and (or) two or more second-degree relatives suffering from esophageal / gastric cardia / gastric defined as upper gastrointestinal tumors (Upper gastrointestinal cancer, UGIC) positive family history.

    The 1.2 specimen collection and peripheral blood leukocyte DNA extraction

    All individuals were collected venous blood 5ml, sodium citrate, 4 ℃ refrigerator. Week after blood collection, proteinase K digestion  salting out, extracted from peripheral blood lymphocyte chromosome DNA.

    1.3 XPA SNP genotyping

    XPA A23G genotyping PCR  RFLP method. The XPA gene A23G PCR reaction system 20μl, which template DNA 100ng 10 × PCR buffer (MgCl2free) 2μl 2.5 mM of MgCl2, Taq DNA polymerase (race Yum) 2.0 U dNTPs 200μM upstream primer 5 ‘ the  TTAACTGCGCAGGCGCTCTCACTC  3 ‘and reverse primer 5’  AAAGCCCCGTCGGC CGCCGCCAT  3 ‘each of 200 nM. PCR conditions: 94 ° C denaturation 5min of denaturation at 94 ° C for 30 s, 58 ° C annealing 20s extension at 72 ° C for 20s, 35 cycles of 72 ° C to continue extending 7min. PCR products were restriction endonuclease MspI (TaKaRa, Dalian) after in 37 ℃ digestion 16h, 4% agarose gel electrophoresis. A / A genotype lack MspI recognition sites to maintain the original post-PCR 158bp fragment, and G / G genotypes of the MspI recognition sites for two DNA fragments of 130 and 28bp, A / G genotype performed 158bp, 130bp and 28bp of the three fragments, as shown in Figure 1.

    1: G / G genotype; 2,5: A / A genotype; 3,4,6,7: A / G genotype; 8: 100bp DNA marker

    Figure 1 XPA A23G genotyping

    XPA G709A genotyping PCR  RFLP method. The XPA gene G709A PCR reaction system 20μl, which template DNA100ng 10 × PCR buffer (MgCl2 free) 2μl 2.5 mM of MgCl2, Taq DNA polymerase (race Yum) 2.0 U dNTPs 200μM upstream primer 5 ‘  TTCATATGTCAGTTCATG  3 ‘and reverse primer 5’ TTTTTCAGAATTGCGT   3 ‘each 200nM. PCR conditions: 94 ° C denaturation 5min, 94 ℃ denaturation 45s, 50 ° C annealing 45s extension at 72 ° C for 45s, 35 cycles of 72 ° C to continue extending 7min. PCR products were restriction enzyme the Taqa1 (TaKaRa, Dalian) 65 ℃ the digestion 16h after, a 4% agarose gel electrophoresis. G / G genotype there the Taqa1 recognition sites of two fragments of 130bp and 18bp, while the A / A genotype lack Taqa1 recognition sites maintained after the original PCR 148bp fragments G / A genotype is manifested 148bp, 130bp and 18bp three fragments.

    For genotyping quality control, each batch of PCR reactions are sterilized distilled water alternative template DNA was used as a negative control, XPA A23G randomly picked 10% of the experiments were repeated.

    1.4 statistical methods

    The chi-square test comparing genotype frequencies of the observed value and the expected value of the Hardy  Weinberg equilibrium analysis. XPA genotype and allele distribution in the case group and the control group was used to compare the list of lines × chi-square test. Application of non-conditional logistic regression model to calculate the odds ratio relative risk (Odds ratio, OR) and its 95% confidence interval (Confidence interval, CI), P <0.05 as statistically significant. Statistical analysis using SPSS11.5 software package.

    2 Results

    2.1 General characteristics

    0.05)。">Gender, age structure between ESCC patients, GCA patients and control groups was similar (P> 0.05). ESCC patients, the group of GCA patients smoking the proportion of individuals with the control group showed no significant difference (χ2 = 0.50 and 3.35, P = 0.48 and 0.07). Family history positive proportion of individuals in UGIC ESCC patients, GCA patients group were 48.0%, 47.8%, 34.2% was significantly higher (χ2 17.22 and 14.19, respectively, P = 0.00), indicating that a UGIC positive family history may be the reason for increased risk of ESCC and GCA (after by gender and age-adjusted OR = 1.76 and 1.77, 95% CI = 1.34 ~~ 2.32 and 1.31 to 2.39), as shown in Table 1. Table 1 esophageal, gastric cardia, and the control group demographic distribution and allele frequency of XPA A23G XPA G709A SNP genotyping analysis was not successful. The XPA A23G SNP analysis was successfully carried out the genotyping, the repeat genotyping results are consistent with the original results. 0.05)。">The chi-square test, XPA A23G SNP genotype distribution in accord with Hardy  Weinberg equilibrium (P> 0.05).

    2.2 XPA gene A23G SNP ESCC, GCA relationship

    2.2.1 XPA gene the A23G SNP and ESCC relationship

    The XPA gene A23G allele frequency between ESCC and healthy controls, the overall distribution of the significant difference (χ2 = 6.39, P = 0.01), as shown in Table 1. The the XPA gene A23G, A / A, A / G, G / G genotype frequencies in the healthy control group were 26.5%, 52.6% and 20.9%, respectively, in the ESCC patients were 37.6%, 42.5% and 19.9%, between ESCC and healthy controls, the overall distribution of the significant difference (χ 2 = 13.27, P = 0.00). Compared with the A / A genotype, G allele (A / G+ G / G genotype), are shown in Table 2. Can significantly reduce the risk of developing ESCC (gender age-adjusted OR = 0.60, 95% CI = 0.45 ~~ 0.80). Stratified analysis showed that, in the non-smoking group in ESCC patients and healthy controls, the genotype frequency distribution was no significant difference (P> 0.05). However, compared with the A / A genotype, with the G allele genotype may reduce the risk of developing ESCC non-smoking group (by gender and age corrected OR = 0.64, 95% CI = from 0.44 ~~ 0.93). Smoking group in ESCC patients and healthy controls, the genotype frequency distribution there is a significant difference (χ 2 = 8.52, P = 0.01), compared with A / A, containing the G allele (A / G+ G / G genotype) can significantly reduce the risk of developing ESCC smoking group (gender and age-adjusted OR = 0.54, 95% CI = 0.35 ~~ 0.84). Between ESCC patients and healthy controls no UGIC family history of the overall genotype frequency distribution of a significant difference (χ 2 = 11.39, P = 0.00), this protective effect is also evident (after by gender and age-adjusted OR = 0.54, 95% CI = 0.37 ~ 0.78). And there is a family history of ESCC patients UGIC patients and healthy controls between the genotype frequency distribution no significant difference (P> 0.05). Table 2 XPA A23G genotype frequencies ESCC, GCA risk of relationship

    2.2.2 XPA gene the A23G SNP and GCA the relationship

    The XPA gene A23G allele frequencies between GCA and healthy controls, the overall distribution was no significant difference (P> 0.05). XPA gene A23G A / A, A / G, G / G genotype frequencies in GCA patients were 34.0%, 47.4% and 18.6%, respectively, between the GCA and healthy controls, no significant differences in their overall distribution ( P> 0.05). However, compared with the A / A genotype containing the G allele (A / G+ G / G genotype) can reduce the risk of developing ESCC (by gender and age corrected OR = 0.70, 95% CI = 0.51 to 0.86). Stratified analysis showed that the non-smoking group, the group of GCA patients the XPA gene A23G A / A, A / G and G / G genotype frequencies were 32.6%, 50.0% and 17.4% in the healthy control group were 25.0 %, 53.4% ​​and 21.6%, genotype distribution between the two groups was significant difference (χ2 = 7.55, P = 0.02). Compared with the A / A, carrying G allele (A / G+ G / G genotype) can significantly reduce the risk of developing GCA in the non-smoking group (gender and age corrected OR = 0.55, 95% CI = 0.36 to 0.85). Overall genotype frequency distribution was no significant difference (P> 0.05) between non UGIC family history and with UGIC family history of GCA patients and healthy controls. Table 3 XPA A23G SNP and among ESCC and GCA incidence risk analysis

    3 Discussion

    Abnormal DNA damage and gene structure, as well as the expression of oncogenes and tumor suppressor genes caused or functional changes may be the premise of malignant transformation. Due to the presence of intracellular DNA repair system, so not all damage can lead to mutations. If the DNA repair system problems, also increases the probability of malignant transformation [7]. Nucleotide excision repair (NER) pathway is a variety of DNA damage, such as UV-induced damage and various chemical carcinogens adduct formation damage repair pathway [5]. XPA as a DNA damage recognition protein, plays a vital role in the NER path, combined with damaged DNA, triggering the repair process. The NER pathway damaged missing XPA gene heaviest.

    Study reported, XPA gene is located on chromosome 9 (9q23.3), its cDNA length 1 377bp, may contain 6 exons encoded protein XPA consists of 273 amino acids, a relative molecular weight of 31 000kDa. XPA protein is a hydrophobic protein present in the nucleus. XPA including three functional areas, N-terminal combined with replication protein A (Replication protein RPA), the C-side mainly in conjunction with transcription factor IIH (Transcription fator IIH, TFIIH) and taken to the injury site; central area of ​​198 to 219 amino acids containing zinc finger structure, and damage the DNA binding function area. Li confirmed XPA protein and ERCC1 combined in a particular way, they think the XPA for excision repair complex ERCC1 and other factors to reach the DNA damage sites indicates the direction of the function.

    XPA polymorphism may affect the stability of the tertiary structure of mRNA transcription factors bind to mRNA or affect. Polymorphic non-coding region of the the XPA gene 5 ‘end, ATG initiation codon four nucleotides upstream, there are A → G [8,9] the XPA gene 5’ non-coding region may transcription post-transcriptional mechanisms regulating gene expression [10], and studies have shown that the A to G can be changed to reduce the risk of lung cancer. Park et al [5] in a small sample of the South Korean that G / G genotype or G allele negative association with lung cancer, especially in young men, this tendency is more pronounced in smokers. Caucasians, Mexicans and African American studies, Wu et al [6] derived G allele-containing genotypes A / A homozygous type can reduce the risk of lung cancer, exposure to tobacco caused cancer populations of this tendency is more obvious. Carry XPA 23G allele, DNA repair capacity than carrying the A / A genotype. Study of esophageal squamous cell carcinoma and gastric cardia adenocarcinoma, we have come to a similar conclusion, carrying the G allele (A / G+ G / G genotype) can significantly reduce the risk of ESCC and GCA . And can significantly reduce the risk of non-smokers suffering from GCA. This study is a population-based case-control genotype distribution of the study, the control group and the patient group were not deviate from Hardy  weinberg equilibrium, good reproducibility of the test results, the basic rule of the systematic errors due to genotype distribution bias.

    But such research retrospective study, there are geographical, racial differences in sample size and study population, and therefore need to be to expand the sample size and in the same race, the same geographical population long-term follow-up study, and further observation XPA gene The state with the interaction of environmental factors and other genetic factors important to reveal the exact relationship of the the XPA gene polymorphism and tumor.