Abstract Objective To study the vincristine induced neuropathic pain whether glial cell activation and its mechanism of action. Methods Rats were repeated injection of vincristine modeling. Immunohistochemical detection of brain and spinal cord, the expression of the specific activation of astrocytes and microglia marker GFAP and OX  42. RT  PCR determination of IL  1β and GDNF mRNA expression in the lumbar spinal cord. Results administration rats reduce mechanical pain reduction and heat pain tolerance threshold in 8 days, 5 days, respectively. See the apparent activation of glial cells in the periaqueductal gray and the gray matter of the spinal cord in rats the administration. Administration group than in the control group IL  1β expression increased, decreased expression of GDNF. Conclusion glial cells in vincristine induced neuropathic pain significantly activated. IL  1β and GDNF vincristine-induced neuropathic pain.

Key words] of vincristine; pain; glial cells; glial cell line-derived neurotrophic factor

   Vincristine is commonly used anticancer drugs, is caused by one of the common drugs for neuropathic pain. In recent years, found that glial cells play an important role in neuropathic pain [1]. Participation of glial cells is unclear whether the vincristine-induced neuropathic pain. Established in this study the vincristine induced rat model of neuropathic pain, testing the activation of glial cells in the brain and spinal cord lumbar and detect the lumbar spinal cord IL  1β, glial cell line-derived neurotrophic factor (Glial cell line  derived neurotrophic factor, GDNF) expression change. Explore the mechanism of of vincristine induced neuropathic pain, and to provide the basis for the search for new treatment strategies.

    1 Materials and methods

    1.1 Grouping and the establishment of an animal model

    20 male Sprague  Dwley (SD) rats, weight about 160g, Hubei College of Traditional Chinese Medicine Laboratory Animal Center, doctors move No. 19-052. UGO Basile 37400 Dynamic Planter mechanical measuring pain meter, 37300 hot plate tester.

    Rats divided into two groups, the random number method measuring the basis weight, mechanical pain threshold and heat pain tolerance time. 1st injection of vincristine 1 day, injected intraperitoneally administered group 1 to 5 and 8 to 12 days 0.1mg · (kg · d) -1 vincristine injection (diluted with saline to 1ml), the control group injected with 1ml saline. Astrometric rats 3,5,8,10,12 weight, mechanical pain threshold and heat pain tolerance, situation while observing rats with exercise, diet and hair removal. Measured mechanical pain threshold and heat pain tolerance time, the first rat set tester 10 ~ 15min until their quiet, twice a measurement interval of 5min, the right and left foot of each repeated three times and averaged.

    1.2 Immunohistochemical detection of glial cell activation

    Glial fibrillary acidic protein (Glial fibrillary acidic protein, GFAP) polyclonal antibody purchased from Neuromarker companies, 1:100 dilution. Microglia flag was OX  42 (CR3, CD11b) monoclonal antibody was purchased from Serotec Company, diluted 1:50.

    12 days from rat brain and spinal cord at the lumbar enlargement (stay 0.5cm extracted RNA). The conventional method for producing thick 30μm frozen sections, the conventional immunohistochemical SP assay GFAP and OX  42 expression. Light microscope to detect the brown DAB positive cells.

    Judgment: Colburn, etc. [2], the activation of a grading method score. Ratings (·): glial cells without activation the branch of glial cells. Score (+): glial cells still branch but activation marker expression, cell density increases. Rating (+ +): the branch of the glial cells decreases the expression of activation markers was significantly increased, sometimes overlapping of cells. Rating (+ + +): glial cell branches chunky, significant increase in activation markers, cells overlap significantly. + + + + All positive.

    1.3 RT  PCR to detect the expression of GDNF mRNA levels in the lumbar spinal cord

    Company the Trizol kit purchased from Hua Shunsheng matter, reverse transcriptase kit purchased from Fermentas PCR kit was purchased from Promega.

    Rapidly taken after the rats were sacrificed at the lumbar enlargement of about 0.5cm spinal cord to join the homogenizer, the reference RNA extraction manual extraction of total RNA. Taken 2μg of total RNA kit instructions, reference RT to synthesize cDNA.

    Within the reference β  actin upstream primer material: 5 ‘ aagatttggcaccacactttctac  3’, reverse primer: 5 ‘ acacttcatgatggaattgaatgt  3’; the IL1  β upstream primer: 5 ‘ TGATGTTCCCATTAGACAGC  3, downstream primer: 5’  GAGGTGCTGATGTACCAGTT  3 ‘ ; of GDNF upstream primer: 5 ‘ CAGCATATGTCACCAGATAAACAAGCGGCGGCA  CT  3’, reverse primer: 5 ‘ CAGGGATCCGGGTCAGATACATCCACACCGTTTAGC  3’ synthesis of biotech companies by the Crown. 1μl cDNA as a template, the reaction of the conventional PCR 50μl system. The ratio of absorbance of the product in ethidium bromide treated agarose gel electrophoresis, the target bands and the inner reference β  actin strip as the relative expression levels, is repeated three times.

    1.4 statistical methods

    Group t test with SPSS11.0 software.

    2 Results

    2.1 vincristine affect the general situation of the rat

    The rat does not appear writhing movement disorders, hair removal. 3 diarrhea in rats administered group and four rats died, no abnormal control rats. Administration group and the basis of the average weight of control rats (156.3 ± 4.6) g and (160.6 ± 5.4) g, respectively, there was no significant difference (P = 0.553). Slow weight gain dose group to 10 days, the administration group and control group difference in weight was significant (P = 0.038).

    2.2 mechanical pain threshold and heat pain tolerance time change

    The hind legs the basis of the treatment group and the control group average mechanical pain threshold and hindlimb base average heat pain tolerance time there was no significant difference. Administered group and the control group to begin eight days of mechanical pain threshold differences were significant differences between the two groups to 12 days maximum, respectively (25.1 ± 4.6) g and (38.3 ± 2.0) g, P = 0.001, dose group than in the control group pain threshold is reduced by 35%, as shown in Figure 1A. The two sets of heat pain tolerance time in five days difference has significant difference on the 8th day of maximum (P = 0.001), and 12 days between the two groups disappeared Figure 1B.

    A: mechanical pain threshold changes;: heat pain tolerance time change; *: P <0.01; ↓: injection of drug or saline

    Figure 1 vincristine mechanical pain threshold and heat pain tolerance time

    2.3 glial cell activation

    Rats administered in the periaqueductal gray and the spinal cord dorsal horn visible GFAP and OX  42 marked activation of astrocytes and microglia, glial cell branches reduced activation marker expression was significantly increased, the cells sometimes overlapping, activation score reached (+ +), the activation of the control group rated both (·). Activation of glial cells in the spinal cord is distributed throughout the spinal cord gray matter, mainly distributed in the dorsal horn of Ⅰ ~ Ⅱ layer, as shown in Figure 2.

    2.4 IL  1β GDNF expression in the lumbar spinal cord.

    Treatment group and the control group IL  1β and β  actin bands absorbance ratio of 1.35 and 1.01, respectively, administered group IL  1β expression increased. GDNF bands within reference absorbance ratio of β  actin bands were 1.76 and 1.20, administered group decreased expression. The same result was repeated 3 times, as shown in Figure 3.

    1: Marker (2kb); 2,4: control group; 3,5: the administered Photos 3 IL  1β and GDNF expression in the lumbar spinal cord.

    3 Discussion

    This model conforms to the basic features of neuropathic pain. Neuropathological cases, disappearance of stimulus duration and intensity of pain generated even without stimulation the pain (Ruhuan limb pain), this type of pain called neuropathic pain. Changchun of alkalis, platinum and taxanes, clinical common cause nerve damage drugs can cause neuropathic pain. Vincristine half-life of 2.37h, clinically visible, however there are still a few months to a few years of pain in patients after discontinuation. The model reference Weng et al [3] as described vincristine induced neuropathic pain model. The pain threshold of the administered group compared to the control group was significantly reduced, and smaller stimulation intensity generated hyperalgesia, as shown in Figure 1, i.e., pain and reduced stimulation intensity, in line with the basic characteristics of neuropathic pain.

    Glial cells involved in the vincristine induced neuropathic pain, suggesting that such pain exist central sensitization mechanism. Vincristine can cause numbness, tingling of the fingers and toes end, but show little damage to the central nervous system symptoms. At present, the mechanism of vincristine induced neuropathic pain is still controversial. Vincristine nervous system can occur demyelination; and its anti-tumor mechanisms of tumor cell microfilaments microtubules interference, so the scholars have speculated that its mechanism is interfering with nerve axoplasmic transport. The neurons most cases in non-mitotic state, microfilaments microtubules are not active; certain drugs acting on microtubules, but does not produce similar neurotoxic symptoms. The axoplasmic transport damage can not fully explain its mechanism. Recently found the original to be regarded as supporting cells, glial cells play an important role in neuropathic pain. Garrison et al [4] the first observed astrocyte activation of the dorsal horn of the spinal cord of rats with neuropathic pain model, and increased activation with increased pain. Glial cells are only distributed in the center, is considered to be one of the mechanisms of neuropathic pain excitability increased microglial activation. In this experiment, activation of glial cells, suggesting that the outer periphery of the vincristine-induced nerve damage in clinical manifestations, the presence of glial cells in the central regulation role. From glial cells in the active site, this regulation occurs not only at the spinal level, but also the brain level.

    Microglial activation after so before the release of proinflammatory cytokines, including IL  1β, IL  6, TNF  α, etc., which in turn activates glial cells and neurons, resulting in pain. This is more recognized glial mechanism. IL  1β administration groups increased expression of this experiment also illustrates this point.

    GDNF and vincristine-induced neuropathic pain. Glial cell line-derived neurotrophic factor (GDNF) 1993 Lin purified from rat glial cell line neurotrophic factor, it can repair nerve damage and pain. Boucher et al [5] found that GDNF protects the partial sciatic nerve ligation (PSL) and the spinal nerve ligation (SNL) model of neuropathic pain, nerve injury, relieve pain; given to NGF and NT3 not be effective. The authors hypothesized that GDNF in neuropathic pain than NGF relationship with pain closer [6]. The present study, the drug group reduced expression of spinal dorsal horn GDNF, suggesting that GDNF with chemotherapy-induced neuropathic pain related, GDNF may be important neurotrophic factor from the nerve repair nerve damage caused by the chemotherapy. In the model, the source and location of GDNF secretion requires further experimental positioning.

    In summary, vincristine-induced neuropathic pain, glial cell activation, suggesting that central sensitization is one of the generation mechanism of this pain. Which may relate to glial cells and the spinal cord dorsal horn GDNF reduce the release of inflammatory cytokines IL  1β increased.