Abstract Objective screening NS gene-specific siRNA-positive cell clones to study the NS gene-specific RNA interference Eca  109 cell lines in vitro proliferation. Liposomes NS specific siRNA expression vector Eca  109 cells transfected Zeocin antibiotic pressure screening positive clones were identified by PCR; MTT assay the growth and proliferation of cells in each group, RT  PCR detection NS gene expression changes. Results Compared with control group, silencer tumor cells tend to differentiation, cell proliferation inhibition rate of more than 80% (P <0.01), the difference was significant; NS gene expression decreased. Conclusion NS gene-specific RNA interference inhibits the proliferation of human esophageal carcinoma Eca  109 cell lines in vitro, the NS gene expression levels decline.

Key words Nucleostemin (NS); RNA interference; esophageal cancer; gene expression; proliferation

    The NS gene scholars of the U.S. National Institutes of Health Mckay and Tsai 2002 a newly discovered protein nuclear factor [1] the genes in stem cells and human tumor cells expressing high abundance, but differentiated adult tissue, the gene is not expressed. The two scholars stem cells and cancer cells by the same protein-NS to determine the ability to replicate in its cells, NS may be stem cells and tumor cells through the G2 / S checkpoint specificity regulatory factors. This article will be human esophageal carcinoma Eca  109 cell lines as experimental material to explore the impact of esophageal carcinoma Eca  109 cell lines in vitro proliferation of the NS gene-specific RNA interference.

    1 Materials and methods

    1.1 Materials

    People of Eca-109 cells were purchased from Shanghai cells; 1640 medium, fetal bovine serum, trypsin (Gibco); PCDNA4 / C  NS  silencer plasmid [2]; MTT, DMSO Zeocin LipofectamineTM2000Reagent: Invitrogen; RNA, DNA kit; RT  PCR kit: TaKaRa Company; primer synthesis: Shanghai Shenergy Gaming Biotechnology Co., Ltd..

    1.2 Methods

    1.2.1 Cell culture and NS gene transfection of Eca-109 cells were cultured in RPMI 1640 medium containing 10% FBS at 37 ℃, 5% CO2 for moist air CO2 incubator culture. Liposome method PCDNA4 / C  the NS  silencer plasmid and empty vector PCDNA4 / C  vector plasmid transfected the Eca  109 cells, were named as the silencer group, vector group, Eca  109 cells untransfected note for the normal group . Transfected cells to the Zeocin antibiotic selection; positive cell clones continue expanding culture medium containing Zeocin antibiotic.

    1.2.2 Identification of positive cell clones extraction cloned cell genomic DNA, in order to Zeocin gene for the purpose of gene by the PCR method exogenous gene integration positive identification of the cell clones as a control, while the tumor cells of the normal group. The primer sequences as follows: upstream primer 5 ‘ atggccaagttgaccagtgc; downstream primer was 5’  tcagtcctgctcctcggcca. PCR conditions: 94 ° C denaturation 5min, then 94 ℃ for 30sec, 60 ° C annealing 30sec, 72 ° C for 30sec, a total of 30 cycles, a final extension at 72 ℃ for 10min; PCR product size of about 370bp.

    1.2.3 growth curve drawing [3] of the three groups of cells reached the 24-well plates (1 × 104 cells / well), each group of 18 wells, respectively, at 24h, 48h, 72h, 96h, 120h, 144h with count plates for viable cell count, plot the growth curves of the cells in each group.

    1.2.4 cell morphological observation groups changes in cell morphology was observed under an inverted microscope.

    1.2.5 MTT colorimetric assay Inhibition of cell proliferation [3] in 96-well culture plates inoculated three groups of cells (n = 24) wells (1 × 103 cells / well), respectively, at 24h, 48h, 72h three time segment MTT assay culture medium blank control and zeroing the absorbance value at 490nm (OD) was measured using a microplate reader, each group was measured 8 wells at a time.

    Cell proliferation inhibition rate = 1 – cell viability

    Cell proliferation inhibition rate = (1-silencer group OD value / Normal group OD value) × 100%

    1.2.6 NS gene expression levels of detection of the tumor cells extracted total RNA from tumor cells, groups of tumor cells NS gene expression by RT  PCR validation. Reference genebank in NS and GAPDH of gene sequences and references [4] primers were designed as follows: NS gene upstream P1: 5 ‘ atgaaaaggcctaagttaaagaaagc downstream P2:’  gctctccaaattctcctttggta; GAPDH upstream P3: 5 ‘ ggtggacctgacctgccgtctaga, downstream P4: 5 ‘ ttactccttggaggccatgtggg; amplified product length 570bp and 280 bp, respectively, within the same system reaction, PCR reaction conditions were 94 ℃ for 5min, 94 ° C denaturation 30sec, 50 ° C annealing 30sec, 72 ° C extending 30sec, a total of 30 cycles. final extension at 72 ℃ for 10min.

    1.2.7 Statistical analysis of experimental data to ± s Statistical analysis using SPSS 11.5 software, t-test.

    2 Results

    2.1 PCR identified by positive cell clones

    Cell clones of the anti-Zeocin part of the PCR product by agarose gel electrophoresis is shown in Figure 1; the Silencer group and vector group are detected Zeocin gene band, while the normal group no, i.e. cell clone exogenous gene integration positive.

    1: normal group; 4: the silencer group of cells cloned; 7: vector set of cell clones; 8: DNA marker: λDNA, Hind III Figure 1 esophageal line Eca  109 positive cells cloned PCR identification results

    2.2 cell growth curve drawing

    The number of each time period the silencer group of cells is lower than that of the control vector group (P <0.01) and normal group (P <0.01), the difference was statistically significant; Cell growth curve shown in Figure 2.

    Figure 2 Cell growth curve

    2.3 morphological changes of the cells

    silencer of cell volume becomes smaller and tend to be uniform, compared with the control vector group and the normal group, the majority of cells from spindle tend rounded, the nucleoplasm smaller, reducing tumor giant cells, cells tends differentiation.

    2.4 MTT colorimetric determination of cell proliferation

    Cell culture 24 hours after the the silencer group of cells proliferation inhibition rates were normal group (P <0.01) 94% and vector group (P <0.01) 93%; cells cultured for 48h, the silencer group cell proliferation inhibition rate for the normal group silencer group cell proliferation inhibition rate (P <0.01) 80% and vector group (P <0.01) 78%; cells for 72h, respectively, for the normal group (P <0.01) of 88% and vector group (P <0.01 ), 87%; cell proliferation curves shown in Figure 3.

    Figure 3 cell proliferation curves

    The 2.5 groups tumor cells NS gene expression levels

    the silencer group tumor cells NS gene expression levels were significantly lower than that of the control vector group and the normal group, as shown in Figure 4.

    1 ~ 3: silencer group; 4 ~ 5: vector group; 7: normal group; 8 DNA marker: λDNA, the Hind Ⅲ Figure 4 groups of tumor cells in the NS gene expression levels of RT  PCR identification

    3 Discussion

    NS gene is a p53-binding protein, found primarily in the nucleolus, a low amount of expression in the nucleus and cytoplasm; pluripotent stem cells in the early state of the gene expression abundance is high, in the beginning of differentiation, this gene The expression suddenly almost completely disappeared. [1] In our laboratory in cooperation with the Chinese Academy of Sciences Institute of Genetics and Developmental Biology, confirmed by a variety of tumor tissues have NS gene expression [5,6], the use of siRNA eukaryotic expression vector, cervical cancer Hella cell proliferation was inhibited intracellular NS gene expression decreased [7,8].

    The experimental vector was transfected PCDNA4 / C  NS  silence human esophageal cancer Eca  109 cells, synchronized PCDNA4 / C  vector empty vector transfected as a control. The positive cell clones after Zeocin antibiotic pressure screening, verify that the cloned cells exogenous genes integrate positive by PCR method. Compare vector and the normal group and the control group, the biological behavior of tumor cells by the Silencer group occurred a significant change, cell proliferation was significantly slower, and tend to be differentiated; MTT method the inhibition of cell proliferation rate measurement the silencer group of cell proliferation rate was significantly lower rate of greater than 80% inhibition of cell proliferation; cells in each group RT  PCR product electrophoresis showed that the the silencer tumor cells NS gene expression was significantly decreased in the two control groups;

    Experimental results show that we build for the NS gene-specific siRNA expression vector PCDNA4 / C  NS  silencer successfully and effectively used, was transfected into human esophageal cancer cells by RNA interference mechanism, so that part of the NS gene silence, resulting in the inhibition of the Eca  109 cell division, proliferation effect. Prompt regulation the NS gene activity in tumor prevention the NS genes can predict the development trend of the tumor, may become a new tumor markers. However, the exact molecular mechanism of the NS protein activity not entirely clear, this still requires a large number of experiments to confirm. The use of RNA interference-depth study of the NS gene likely will reveal or partially reveal the stem cells and tumor cell proliferation of the fans, for the early diagnosis of tumors, gene therapy and prognosis and stem cells as the basis of tissue engineering, etc. to provide theoretical basis and work foundation.