[Abstract] Objective To investigate for human telomerase RNA (hTR) and the catalytic subunit (hTERT) small interfering RNA (siRNA), kidney cancer telomerase activity, proliferation and apoptosis. RNA (hTR)  siRNA, hTERT  siRNA (100nmol / L) alone or in combination with transfected human renal cell carcinoma (RCC) 786  0 cells by RT  PCR assay RNA (hTR) of hTERT mRNA expression and telomerase activity of TRAP  ELISA assay, MTT assay cell proliferation, apoptosis immunohistochemical TUNEL assay. Results (1) hTR  siRNA can significantly reduce the 786  0 cells hTR mRNA expression (P <0.01), hTERT  siRNA significantly reduced hTERT mRNA expression (P <0.01), but not impact other areas. (2) both can significantly inhibit telomerase activity (P <0.01, P <0.01), and increased 786  0 cell proliferation inhibition rate and positive rate of apoptotic cells (P <0.01, P <0.01). 0.05)。">The combination application and a separate application there was no significant difference (P> 0.05). Conclusion RNA (hTR), hTERT siRNA inhibition of human renal cancer telomerase activity by inhibiting the expression of each gene, thereby inhibiting the proliferation and promote apoptosis.

Key words】 kidney cancer interfere with the RNA telomerase RNA telomerase reverse transcriptase

    Telomerase is activated lead to unlimited proliferation of tumor cells, inhibition of telomerase activity in tumor cells can not be synthesized telomeres and apoptosis is therefore ideal target for cancer treatment [1]. Telomerase mainly by the telomerase RNA (hTR) and telomerase reverse transcriptase (hTERT). Telomerase hTR as a template to synthesize telomeric DNA, hTERT is the rate-limiting enzyme catalytic reaction only. RNA interference could be specifically efficient repressor of target gene expression, is expected to become a powerful tool for cancer gene therapy. We Inhibitory RNA interference RNA (hTR) expression of hTERT, to observe the impact of kidney cancer, telomerase activity and proliferation, apoptosis.

    1 Materials and methods

    1.1 Materials

    Human renal cell carcinoma cell lines 786  0 saved by the chamber. hTR  siRNA, hTERT  siRNA, negative control siRNA, siRNA transfection kit by Ambion, USA. Total RNA extraction kit and RT  PCR kit, Promega Corporation, USA. TRAP  ELISA telomerase activity detection kit was purchased from Roche. Situ end apoptosis detection kit was purchased from Santa Cruz.

    1.2 Methods

    1.2.1siRNA design, synthesis

    Ambition companies design, synthesis for human telomerase the hTR sequence and hTERT gene dominant negative mutant (NM003219, nucleotide sequence position 2182 to 2200), the siRNA. hTR sequence is as follows: sense strand: 5 ‘ UUGUCUAACCCUAACUGAGtt  3’, antisense strand 3 ‘of  ttAACAGAUUGGGAUUGACUC ’. hTERT sequence is as follows: sense strand 5 ‘ CAAGGUGGAUGUGACGGGCtt ’. the antisense strand ‘of  ttGUUCCACCUACACUGCCCG ’. And RNA (hTR) gene database search confirmed outside of hTERT gene sequence homology.

    1.2.2 Cell culture and transfection

    786  0 cells cultured in RPMI  1640 containing 10% FCS in regular 48h, transfection kit hTR  siRNA, hTERT  siRNA adjusted to a final concentration of 100 nmol / L, alone or in combination added to cultured cells, another with saline (blank), liposomes, negative control siRNA as a control. Culture 24h after detection of RNA (hTR) / of hTERT mRNA expression and telomerase activity, 72h to detect cell proliferation and apoptosis.

    1.2.3RT  PCR

    Extraction of total RNA, RT  PCR kit, one-step line RT  PCR reaction. hTR, downstream primer sequences are as follows: 5 ‘ CTGGGAGGGGTGGTGGCCATTT  3’, 5 ‘ CGAACGGGCCAGCAGCTGACAT  3’. the hTERT primers were: 5 ‘ GCCAGAACGTTCCGCAGAGAAAA  3’, 5 ‘ AATCATCCACCAAACGCAGGAGC  3’. GADPH gene as an internal reference. PCR products on 1% agarose gel electrophoresis, an ultraviolet camera and scanning analysis, to hTR, hTERT / GADPH expression level semi-quantitative analysis.

    1.2.4 Determination of telomerase activity

    Telomeric repeat amplification  enzyme-linked immunosorbent assay (TRAP  ELISA) to detect telomerase activity calculated according to A = A450  A690, and the ratio calculated with the blank control group. The specific steps according to the instructions.

    1.2.5MTT assay cell proliferation

    Treated 786  0 the cells were MTT10μl / hole (5mg/ml), cultured for 4h suck supernatant was discarded. Add dimethylsulfoxide 100μl / hole, and to dissolve the purple formazan crystals, and measured the absorbance microplate reader at 570nm wavelength A value, the inhibition rate was calculated.

    1.2.6TUNEL assay of apoptosis

    786  0 cells fixed on the slide after washing with Triton  100 co-incubated 2min dropwise addition, the TUNEL reaction mixture, in the wet box 37 ℃ incubation 1H, washed 3 times with PBS, the diaminobiphenyl stained, after washing mounted. High magnification were counted five fields, the nucleus was brown is positive, calculate the percentage of positive cells.

    2 Results

    2.1siRNA 786  0 cell RNA (hTR), hTERT mRNA expression

    0.05)。">HTR mRNA levels compared with negative siRNA control group, RNA (hTR)  siRNA group was significantly lowered (P <0.01) of hTERT mRNA did not change significantly (P> 0.05). 0.05),见表1。">hTERT mRNA level of hTERT  siRNA group was significantly lower (P <0.01) and no significant change (P> 0.05), RNA (hTR) mRNA levels are shown in Table 1. Table 1 RNA (hTR)  siRNA, hTERT  siRNA kidney cancer 786  0 cells Note: compared with negative siRNA group, # P> 0.05, * P <0.012.2siRNA on 786  0 cells telomerase activity in

    0.05)。">hTR  siRNA and hTERT  siRNA could significantly inhibit telomerase activity (P <0.01), but the difference was no significant (P> 0.05). 0.05),见表2。">The combined group and single-group difference was not significant (P> 0.05), see Table 2. Table 2hTR  siRNA of hTERT  siRNA for kidney cancer 786  0 telomerase activity and proliferation of apoptosis of Note: compared with negative siRNA group, * P <0.01; between three sets of pairwise comparisons, # P> 0.052.3siRNA 786  0 cell proliferation

    0.05)。">hTR  siRNA and hTERT  siRNA could significantly inhibit 786  0 cell proliferation, the difference was no significant (P> 0.05). 0.05),见表2。">The combined group and single-group difference was not significant (P> 0.05), see Table 2.

    2.4siRNA 786  0 apoptosis

    0.05)。">hTR  siRNA and hTERT  siRNA significantly promoted apoptosis of 786  0, the difference was no significant (P> 0.05). 0.05),见表2。">The combined group and single-group difference was not significant (P> 0.05), see Table 2.

    3 Discussion

    Telomeres in the linear chromosome ends, every cell division a telomeric sequence shortened 50 ~ 200bp apoptosis [2], when shortened to a critical length. Telomerase catalytic synthesis of a ribonucleoprotein maintaining telomere length, telomerase catalytic subunit (hTERT) by the telomerase RNA (RNA (hTR)), it can hTR as a template in the hTERT catalyzed synthesis telomere, in order to compensate for the shortening of telomeres [3]. Cancer cells due to the activation of telomerase to chromosome telomere maintenance in a certain length, on the one hand, the cells receive eternal life, on the other hand that the cell cycles faster growth [3]. The study confirmed for RNA (hTR) of hTERT antisense nucleic acids by inhibiting telomerase activity, inhibit cell proliferation and induce apoptosis [1,4]. Kanaya et al [5] reported RNA (hTR) of hTERT detection rate of renal cell carcinoma were 80%, 86%, and its expression and telomerase activity was positively correlated with normal renal tissue expression of hTERT, therefore RNA (hTR) of hTERT is kidney effective target for cancer gene therapy.

    RNA interference is a small piece of double-stranded RNA (siRNA)-mediated transcriptional gene silencing technology. binding of the siRNA into the cell with the RNA-induced silencing complex (RISC) and RISC effect specific degradation of the target gene mRNA, the efficiency is 100 times stronger than the single-stranded antisense RNA [6], siRNA can be suppressed in vivo oncogene expression and inhibit tumor growth [7]. The study found that siRNA can inhibit renal cancer cell RNA (hTR) and hTERT gene expression, and has a high degree of specificity. hTR, hTERT expression inhibition of telomerase activity decreased kidney cancer. Both inhibit telomerase activity similar to that associated with nor enhanced inhibition. Our findings with Kosciolek consistent with the results obtained in the colon, cervical cancer cells [8].

    The study also found that hTR  siRNA and hTERT  siRNA has similar inhibition of renal cancer cell proliferation, promote apoptosis, the combination can not increase its role. Decline in telomerase activity, usually take several weeks, tumor cells after several generations of separatist telomere shortening to a critical value to apoptosis [9]. But if the tumor cells telomere capping extend the functionality of having a defect, tumor cells can occur immediately proliferation, increased apoptosis [10]. 72 hours the siRNA treated cells that appear inhibition of proliferation and increased apoptosis, may extend the 786  0 telomere capping function defects.