Abstract Objective To study the transfer of 4  1BBL gene mouse hepatoma cell vaccine in vitro stimulation of syngeneic murine spleen cells to produce cytokines (IL  2, TNF  α and GM-CSF). Of liver cancer cells in mice treated with mitomycin C (MMC) high expression turn m4  1BBL gene Hepa1  6, made of tumor cells, tumor cell vaccine (TCV), after co-cultured in vitro with syngeneic murine spleen lymphocytes, observed spleen cells produce cytokines (IL  2, TNF  α and GM-CSF) impact. The results the TCV  4  1BBL stimulated spleen cells in vitro secretion of cytokines IL  TNF  α and GM  CSF levels were significantly increased. Conclusion turn of 4  1BBL gene mouse hepatoma cell vaccine can stimulate the spleen cells to produce cytokines IL  2, TNF  α and GM-CSF.

【Key Words】 mouse  1BBL; costimulatory molecules; tumor vaccine; HCC; cytokine

    Immunity mainly by the body of the tumor cell immunity, particularly T cell immunity. Providing a second signal and the activation of T cells in addition to the MHC  antigen polypeptide complex with the binding of the T cell receptor (TCR) are provided on the first signal, costimulatory molecules (Costimulatory molecules) also plays a vital role in [1]. The lack of these costimulatory molecules will cause the T cells to enter the clone incompetent or apoptosis. Therefore, the costimulatory molecules into tumor cells to produce tumor vaccines become the recent research focus of tumor biological treatment. We found in studies in mouse hepatoma cells Hepa1  6 to import 4  1BBL gene can significantly enhance the body induce immune responses [2], the application of the above genetically engineered tumor vaccine was studied in vitro stimulation of syngeneic mice spleen cells produce cytokines (IL  2, TNF  α and GM-CSF) the ability to produce its anti-tumor machine further discussion.

    1 Materials and Methods

    1.1 Materials mouse hepatoma cell line Hepa1  6 by International Cooperative Oncology Institute of Shanghai Second Military Medical University, Professor Guo Yajun benefits, gifts, turn m4  1BBL gene expression cell lines Hepa1  6  m4  1BBL transfected with empty vector Hepa1  the 6  neo is of establishing [3] DMEM medium, newborn calf serum from Gibco Hangzhou Evergreen products. Rat anti-mouse 4  1BBL antibody (BD) were purchased from Shenzhen Jingmei, goat anti-rat IgG FITC PHA  P, MTT, DMSO, Sigma. Mitomycin C (MMC) for Kyowa Hakko Kkgyo company products. TRIzol reagent and superscript Ⅱ reverse transcriptase kit from Invitrogen. Taq enzyme Huamei products. C57BL / 6 mice were purchased since the Fourth Military Medical University Experimental Animal Center, 6 weeks old, female. Lymphocyte separation medium was purchased from TBD Biotechnology Development Center. Actinomycin D (ACD) Fluka company’s products. IL  2 standard TNF  α standard, GM  CSF standard of the Fourth Military Medical University Biotechnology Center and Department of Immunology. L929 cell line, TF  1 cell line for the Fourth Military Medical University, Department of Immunology. The primers were synthesized by Shanghai Sangon company, according to the the gene GeneBank m4  1BBL, full-length sequences upstream primer P1: 5 ‘ GCGGATCCATGGACCAGCACACACTTGA  3 the downstream primers P2: 5’  CGGATTCTCATTCCCATGGGTTGTCGG  3 ‘. Expected to be amplified fragment length 945bp.

    1.2 Methods

    1.2.1 tumor cell vaccine preparation

    Collect the culture Hepa1  6 Hepa1  6  neo Hepa1  6  m4  1BBL cells, 1 × PBS solution washed 2 times, the cell number was adjusted to 1 × 1010 / L, MMC (80mg / L) at 37 ℃ , 50% CO2 for 1h, 1 × PBS were washed three times, resuspended cells, made of a tumor cell vaccine spare (respectively called TCV of  Hepa1  6, the the TCV  Hepa1  6  neo TCV-of  m4  1BBL).

    1.2.2 MMC treated cells transfected m4  1BBL expression changes

    After taking the logarithmic phase Hepa1   m4  1BBL cells stably expressing the cloned Shop 6-well plates in a concentration of 1 × 105 / well for 48h, 1 × PBS washed 2 times with MMC (80mg / L) in 37 ℃, 50% CO2 for 1h, washed 3 times with 1 × PBS, re with complete culture medium, respectively, in the role before, 6h role after 24h, 48h the cells were collected to extract total RNA for RT  PCR detection.

    1.2.3 C57BL / 6 mouse spleen cell suspension preparation and mixed lymphocyte culture

    Sterile conditions. C57BL / 6 mice spleen sterile glass needle core grinding and over 150 mesh screen, prepare single cell suspension, RPMI1640 washed once RPMI1640 containing 10% fetal bovine serum resuspended cells, adjusting the cell concentration 1 × 107/ml, set 12-well culture plates were added to the culture medium, TCV  Hepa1  6 the TCV-Hepa1  6  neo TCV  m4  1BBL cell concentration of 5 × 105 / ml (spleen cells with TCV proportion of 20:1), 37 ° C, 50% CO2 culture 36h, the culture supernatant was collected by centrifugation, for detecting a cytokine.

    1.2.4 IL  2 Determination

    MTT assay mother mouse spleen T cells [4]. Lyse erythrocytes sterile conditions in C57BL / 6 mouse spleen, grinding, over a 150 mesh steel mesh, 0.87% ammonium chloride (30 ~ 60s), PBS washed 3 times, with 15μg/ml PHA was  P-containing, penicillin 100U/ml streptomycin 100μg/ml, 10% newborn calf serum 1640 medium made of 1 × 107/ml cell suspension, 37 ° C, 50% of CO2 cultured for 48 to 72h, the separation of the cell suspension with lymphocyte separation medium 1500r / min for 15min, taking the middle layer lymphocytes. Washed twice with PBS, counted, adjusted the cell concentration of 1 × 106/ml. Taken 100μl of the sample and dilution IL  2 standard (concentration of 100U/ml), for the dilution within the 96-well culture plate, three holes and the negative control (culture medium), each hole and adding the above The cell suspension of 100 μl at 37 ° C for 50% of CO2 culture 24h, or observation to the death of all of the negative control group cells, MTT assay. Added to each well in 96-well culture plates MTT 20μl, 37 ℃, 50% of CO2 culture 4 ~ 6h, centrifuged at 1000 r / min, 5min, suction supernatant was removed and added to each well DMSO200μl full wind and percussion mix or overnight in the enzyme 570nm absorbance value (A) was measured on the standard analyzer.

    Formula: IL  2 the active units = (up to 50% of the maximum value of A sample dilution / up to 50% of the maximum value of A standard dilution) × standard units

    1.2.5 TNF  α Determination

    MTT assay for cytotoxic effects on mouse L929 cells [4]. Detecting when the cell suspension were collected and washed 3 times with PBS, adjusted the cell concentration of 2 × 105/ml. Per well in 96-well plates, 100 μl of 37 ° C, 50% CO2 cultured 24h, the supernatant was discarded. Taken to 100μl by the sample and dilution of TNF-α standard (concentration of 100U/ml), in a 96-well culture plates for dilution set of three holes and negative control (culture medium) group, each hole and add another actinomycin D 10 μl of 37 ° C, 50% of CO2 cultivate 12 ~ 14h, or observation to the negative control group cells all died, joined by MTT 10 μl of each well at 37 ° C, 50% CO2 train 4 ~ 6h, suck abandoned on clear, added to each well DMSO 100μl, after the shock 570nm A value measured on ELISA analyzer

    TNF  α standard dilution formula: TNF  α activity units = (50% cell death / cause 50% cell death TNF  α sample dilution) × standard units

    The 1.2.6 GM  CSF Determination method

    GM  CSF dependent TF  1 cell line as target cells in the MTT assay [4]. RPMI1640 medium containing 10% fetal calf serum, GM  CSF 60u/ml of culture TF  1 cells, detection collected cell suspension was washed 3 times with PBS, adjusting the cell concentration of 1 × 105/ml. Taken to 100μl by the sample and dilution of GM-CSF standard (concentration of 200U/ml), in a 96-well culture plates for dilution set of three holes and negative control (culture medium) group, each hole and add another the cell suspension 100μl, 37 ℃, 50% CO2 for 24h, or to death of all of the negative control group cells, MTT assay was observed. Added to each well in 96-well culture plates MTT 20μl, 37 ℃, 50% of CO2 culture 4 ~ 6h, centrifuged at 1000 r / min, 5min, suction supernatant was removed and added to each well DMSO200μl full wind and percussion mix or overnight in the enzyme The standard analyzer Determination 570nm absorbance (A) values.

    Formula: GM  CSF activity units = (sample up to 50% of the maximum value of A standard dilution / standard dilution of 50% of the maximum value of A) × standard units

    1.2.7 Statistical Methods

    Results SPSS10.0 statistical software line variance analysis, P <0.05 as a significant difference.

    2 Results

    The 2.1 MMC before and after tumor cell expression m4  1BBL changes

    RT  PCR detection Hepa1  6  m4  1BBL cells after MMC role after 48h able to express m4  1BBL, as shown in Figure 1.

    1: DL  2000; 2: MMC role before;: MMC role after 6h; 4: MMC for 24h;: to MMC 1 MMC before and after 48h after m4  1BBL expression

    2.2 tumor cell vaccine spleen cells produce cytokines

    The the wild type Hepa1  6 Hepa1  6  neo transgenic cells Hepa1  6  m4  1BBL after role of mitomycin C with fellow C57BL / 6 mouse spleen cells co-cultured and cultured for 36h after clear for the detection of relevant cytokines results show turn of 4  1BBL gene tumor vaccine in vitro stimulation of spleen cells to produce IL  TNF  α and GM  CSF were increased. Statistical analysis showed significant differences with the wild-type Hepa1  6 cell vaccine (P <0.05), see Table 1. Table 1 Liver Cancer Vaccines spleen cells produce cytokines turn 4  1BBL comparison with the wild group and empty vector group, P <0.05

    3 Discussion

    4  1BBL is a tumor necrosis factor superfamily member, belonging to the membrane surface of the II type glycoproteins, mainly expressed on activated antigen presenting cells such as B cells, macrophages, dendritic cells, some of the tumor cells can also be expression 4  1BBL [5]. 4  1BBL their receptor 4  1BB role can regulate a variety of immune cell function, can effectively co-stimulation of T cells, and allowed to proliferate, increase their cytolytic capacity [6]. Therefore, the application of of 4  1BBL induce the body’s anti-tumor T cell response that has a broad prospect.

    4  1BBL in anti-HCC immunity 4  1BBL genes into known not to express 4  1BBL mouse hepatoma cells and made Hepa1  6 in tumor vaccine, in order to ensure the desired tumor cells vaccine to maintain its high immunogenicity and low tumorigenic In the experiment with the right dose of mitomycin C-treated tumor cells, the results showed that treatment of mitomycin C 48h tumor cells can express 4  1BBL, and bottle some of the cells in culture can be maintained adherent week or so, not in mice inoculated with this tumor vaccine into the tumor.

    The past 4  1BBL priority in vivo induction of CD8 + T cell activation [7]. More recently, however, the Cannons JL et al reported of 4  1BBL stimulation of CD4 + T and CD8 + T cells in the event of cell division, to maintain the survival and enhanced effector function, there is no significant difference [8]. CD8 cytotoxic T lymphocyte surface markers. CD4 is a the TH cell surface markers. Currently, tumor immune activation of MHC  I-restricted CD8 + T lymphocytes, MHC  II molecules restricted CD4 + T cell activation have great significance to maintain CTL killing activity and immune memory. CD4 + TH1 cells can produce IL  2, IFN  γ, TNF  α and GM-CSF and other cytokines. M4  1BBL gene transfection Hepa1  6 cell vaccine more effective induction of CD8 + T lymphocytes specific killing activity for the wild-type Hepa1  6 cells found in the previous experiments. The results of this study show that the TCV  4  the 1BBL vitro and spleen lymphocyte co-culture supernatant IL  TNF  α and GM  CSF level increased significantly, which also shows of 4  1BBL not only stimulate the induction of CD8 + T cell activation, and also activation of CD4 + T cells to produce cytokines, these cytokines indirectly activate CD8 + cells may be one of the mechanisms of its antitumor.
