【Abstract】 Objective To investigate the possibility of survivin antisense nucleic acid-induced apoptosis in HeLa cells reveal the relationship between 2 and Bax apoptosis and Bcl . Methods TUNEL staining, to study the relationship of the survivin antisense nucleic acids and apoptosis in HeLa cells; chemical assay of apoptosis related genes Bcl  2 and Bax expression by immunohistochemistry. Survivin antisense RNA in vitro can induce apoptosis in HeLa cells, down Bcl-2 expression, enhanced expression of Bax. Conclusion induced apoptosis in HeLa cells the survivin antisense nucleic acid resistant HeLa role of one of the mechanisms of survivin antisense nucleic acid may by down-regulating expression of Bcl  2 expression, enhanced expression of Bax, induction of apoptosis in HeLa cells.

【Keywords】 antisense oligonucleotide; cervical cancer; HeLa cells; apoptosis

Apoptosis in HeLa Cells Induced by Antisense Oligodeoxynucleotide of Human survivin Gene

    YIN Qing 1, HUANG Hao2

    1.Department of Obstetrics & Gynecology, Liyuan Hospital, Huazhong University of Science and Technology, Wuhan 430030, China; 2.Center of Experimental Medicine, Wuhan First HospitalAbstract: Objective To investigate the apoptosis in HeLa cell induced by antisense oligodeoxynucleotide of human survivin gene , and the relation between this apoptosis and expression of Bcl  2 and Bax.Methods In vitro experiments, TUNEL staining method was used to detect the apoptosis status of cervical cancer HeLa cell line treated by antisense oligodeoxynucleotide of survivin.Immunohistochemical staining was used to detect the expression of apoptosis  relation gene Bcl  2 and Bax.Results Antisense oligodeoxy nucleotide of survivin was able to induce the apoptosis in HeLa cells.Antisense oligodeoxynucleotide of survivin can reduce the expression of apoptosis  relation gene Bcl  2 and increase the expression of apoptosis  relation gene Bax.Conclusion Antisense oligodeoxynucleotide of survivin was able to induce the apoptosis in HeLa cell.This apoptosis may be mediated by down  regulation of apoptosis  regulated gene Bcl  2 and up  regulation of Bax.

    Key words: Antisense oligonucleotides; Cervical cancer; HeLa cell line; Apoptosis

survivin apoptosis inhibitory protein discovered in recent years (inhibitor of apoptosis protein, a new member of the IAP) family, is an important ingredient to inhibit apoptosis plays an important role in the development of malignant tumors [1]. Existing research results show that survivin was highly expressed in HeLa cells, and its expression of the extent and degree of malignancy and invasion and metastasis is closely related to [2]. Therefore, the inhibition of the expression of survivin is expected to be an effective means for the treatment of cervical cancer. We synthesized the gene for human survivin antisense justice nucleic acid by TUNEL staining, in vitro qualitative and quantitative study of the relationship between survivin antisense oligonucleotide with HeLa cells apoptosis; simultaneously by immunohistochemical assay of apoptosis-related genes Bcl  2 and Bax expression study the survivin antisense nucleic acid-induced apoptosis in HeLa cells possible mechanisms.

    1 Materials and methods

    1.1 Materials

    HeLa cells were purchased from Wuhan University of Life Sciences. Situ apoptosis detection kit, SABC reagent box and Bcl  2, Bax monoclonal antibody products, biotech companies are Zhongshan. of survivin antisense: 5 ‘ CCCAGCCTTCCAGCTCCTTG  3’; survivin (justice): 5 ‘ GTTCCTCGACCTTCCGACCC  3’, no homology to known human genes were confirmed by outside computer online search and survivin gene. Synthesized by Shanghai Biological Engineering Company, wholly phosphorothioate.

    1.2 Methods

    1.2.1 Cell culture HeLa cells grown in adherent containing 10% fetal bovine serum, penicillin the 100u/ml and streptomycin 100mg/ml RMPI  1640 culture medium and placed in 37 ° C, 5% CO2 humidified incubator cultured and subcultured once every two days for the fluid, when 80% of the cell fusion. All experiments were performed using the cells in the exponential growth phase.

    1.2.2 survivin antisense nucleic acid-induced apoptosis in HeLa cells (TUNEL staining) set coverslips in 6-well cell culture plate. Take Exponentially growing HeLa cells (cells 105/ml) 0.4ml Shop on coverslips. 37 ℃ incubated until the cells adherent growth. Each hole plus containing the the survivin antisense nucleic 10μmol / L culture medium 3ml total sterility and cell time for 24,36,48,72 h. Each time group located PBS control holes. Discard hole culture fluid, and 10% formaldehyde. PBS buffer, washed, and 0.3% over 0.1% Triton  × 100 processing cells  methanol solution of hydrogen peroxide and precooled. DAB color. Cell nuclei were stained brown sentenced to apoptotic cells. 1000个细胞),凋亡指数AI=凋亡细胞数÷总细胞数×100%。">Randomly selected 50 high-power field (> 1000 cells), apoptotic index AI = number of apoptotic cells ÷ total cell number × 100%.

    1.2.3 Immunohistochemical assay Bcl  2 and Bax protein expression in cell processing Ibid, survivin antisense nucleic acids and cells were sterile 24,36,48,72 h, discard hole culture medium, fixed in 10% formalin. Citrate buffer, washed, microwave treatment 10min. DAB color. Light microscope. The expression of Bcl  2 and Bax positive reaction to yellow to brown, can also be found in the cell membrane and nuclear membrane located in the cytoplasm.

    1.2.4 Statistical methods All data processing Press the Ridit analysis method.

    2 Results

    2.1 survivin antisense oligonucleotide induced apoptosis in HeLa cells

    Light microscope examination showed that survivin antisense oligonucleotide (10μmol / L) treated HeLa number of apoptotic cells increased significantly, as shown in Table 1. The brown stain particles located in the nucleus. The positive staining of HeLa cell nuclear fragmentation, nuclear pyknosis, membrane prominent formation of apoptotic morphological changes of plasma membrane vesicles. Table 1 survivin antisense oligonucleotide induced apoptosis in HeLa cells number

    2.2 Bcl  2 and Bax protein expression

    of survivin justice nucleic acid treated HeLa cells, Bcl  2 protein product + + ~ + + + (including three cases stained specimens + specimens + + +), survivin antisense oligonucleotide (10 μmol / L 24h) in the treatment group, Bcl  2 protein product – ~ + (5 cases stained specimens -, 2 specimens +). After inspection of Ridit method survivin antisense oligonucleotide Bcl  2 protein product expression can significantly reduced (P <0.05). the survivin justice nucleic acid treated HeLa cells, the the Bax protein product stained – ~ + (5 specimens – specimens +) of survivin antisense oligonucleotide (10μmol / L, 24h) treatment group, Bax protein continued to show a product of staining + + + + (which 3 specimens + specimens + specimens + + +). After pairing Ridit law test, survivin antisense oligonucleotide Bax protein expression of enhanced (P <0.05).

    3 Discussion

    survivin not only inhibits apoptosis, but also regulate mitosis. Selectively expressed in the common variety of malignant tumors, and in adjacent normal tissues and differentiated adult tissues do not express [3  4]. Can be used as a potential drug target and cause for concern.

    Our synthetic survivin antisense justice nucleic acid research function induced apoptosis in HeLa cells. The results confirmed the survivin antisense nucleic acid with induction of apoptosis in HeLa cells and found HaLa number of apoptotic cells increased significantly with time, and further confirmed survivin antisense oligonucleotide killed HeLa cells by inducing apoptosis.

    Bcl  2 family is recognized apoptosis suppressor gene can inhibit a variety of factors, such as oxygen free radicals and p53-induced apoptosis [5  7]. This study shows that untreated HeLa cells, Bcl  2 expression of Bcl  2 protein expression was significantly down-regulated after survivin antisense nucleic acid processing; Bax Bcl  2 homolog. HeLa cells, the expression of Bax deletion after survivin antisense nucleic acid processing, Bax gene enhanced the expression of Bcl  2/Bax ratio decreased, this may be one of the molecular mechanisms of survivin antisense nucleic acid-induced apoptosis in HeLa cells.
