[Abstract] Objective To investigate the RhoC gene overexpression of endothelial cells in vitro migration and angiogenesis process. Constructed RhoC eukaryotic expression vector, liposomal transfection of human umbilical vein endothelial cells (HUVE) RhoC mRNA and protein levels by RT  PCR and Western blot; scratches cell migration assay; collagen matrix gel The three-dimensional culture detection ability of endothelial cells in vitro angiogenesis. The transfection results the RhoC experimental group compared with the empty vector control group of RhoC mRNA and protein expression was significantly higher; significantly enhanced cell migration and vessel-like structure generation capacity. Conclusion the RhoC high expression can promote human umbilical vein endothelial cell migration and angiogenesis.

Key words RhoC; human umbilical vein endothelial cells; cell migration; angiogenesis

Overexpression of RhoC Affects Human Umbilical Vein Endothelial Cell Migration and Angiogenesis in Vitro

    ZHAO Liang  ping1, ZHANG Qing  hua1, WANG Wei  na2, TIAN Xun1, LIANG Feng  qi1, HUANG Lei1, XIONG Guo  ping1, MA Ding3

    1.Department of Gynecology & Obsterics, The Central Hospital of Wuhan, Wuhan 430014, China; 2.Department of Cardiology, Zhongnan Hospital, Wuhan University; 3.Department of Gynecology & Obsterics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and TechnologyAbstract: Objective To investigate the effects of RhoC overexpression on human umbilical vein endothelial (HUVE) cell migration and angiogenesis in vitro.Methods Transfecting RhoC gene into HUVE cells by Lipofectamine  2000.The expression of RhoC mRNA and protein were detected respectively by RT  PCR and Western blot, respectively.Wound assay in vitro and three  dimensional culture were used to detect the migration and angiogenesis capacity of HUVE.Results RhoC expression was increased by transfecting RhoC gene into HUVE, meanwhile, the cells migration and angiogenesis capacity were enhanced.Conclusion RhoC may increase the capacity of HUVE migration and angiogenesis in vitro.

    Key words: RhoC; Human umbilical vein endothelial cells (HUVE); Migration; Angiogenesis
RhoC small G globulin superfamily members of the Rho family (RhoGTPases) as cell migration start regulating the key molecules involved in cell head pseudopodia extension, contraction and cells in the body and tail of the new adhesion process, malignant tumors play a role of the process of transformation, proliferation, invasion and metastasis [1  3], and have a strong impact on blood vessel formation. The study by RhoC transfected human umbilical vein endothelial cells to detect the expression of cell RhoC vitro migration and vessel-like tissue formation, so as to explore the role of RhoC in endothelial cell migration and angiogenesis.

    1 Materials and methods

    1.1 Main material

    Fetal bovine serum, DMEM, TRIZOL reagent (Gibco), human umbilical vein endothelial cell line HUVE (Wuhan University Type Culture Collection), RT  PCR detection the kit (TaKaRaBiotechnology company), PCR product recovery kit, type I collagen protein (Sigma), vector plasmid for PEGF  C1 (Clontech Company), BamHI, with EcoR Ⅰ, T4 connection enzymes, of RhoC antibody and β  actin antibody (Santa Cruz Company), plastic recycling kit (Shanghai Hua instantaneous biological company).

    1.2 Cell culture

    Human umbilical vein endothelial cells lines HUVE (Wuhan University Type Culture Collection), DMEM medium (Gibco) containing 10% fetal bovine serum (Gibco), at 37 ° C, 5% CO2 for cultivation.

    1.3 pEGFP  C1  RhoC plasmid

    Full-length cDNA sequences according to the the Genebank log RhoC the Primer preimier software design RhoC primer: For: 5 ‘ CGGAATTCTCCTCATCGTCTTCAGCAAG  3’ containing BamH Ⅰ restriction sites; Rev: 5 ‘ CGGGATCCCATAAGGGCTGTGCTTGCAG  3’; containing EcoR Ⅰ enzyme cut sites; total cellular RNA as a template, PCR amplification of the RhoC gene fragments, and insert it into the eukaryotic expression vector CMV promoter downstream of pEGFP  C1 construct pEGFP  C1  RhoC expression plasmid, the plasmid carrying new neomycin gene (NEO gene), transformed into E. coli DH5α, positive selection after conventional amplification the monoclonal enzyme digestion and sequencing. The primer synthesis and DNA sequencing analysis completed by Takara Co., Ltd..

    1.4 liposomes (Lipofect-2000, LF) mediated transfection

    LF manual in 6-well plates were transfected. Pre HUVE seeded in 6-well plates, 2 × 105 / holes from 50% to 80% to be cell fusion were transfected of recombinant pEGFP  C1  RhoC (experimental group) and the empty vector pEGFP C1 (control group), 4h After adding 10% serum terminated. Three-dimensional culture after 12h and 24h after the scratch test. 72h observed by fluorescence microscopy transfection efficiency of about 30%, and the cells were collected by extraction of total RNA and protein using RT  PCR and Western blot detection experimental group and a control group of RhoC gene expression levels. RhoC and GAPDH ratio indicates the relative RhoC mRNA expression levels; to of RhoC with the β  actin ratio indicates the relative expression levels of RhoC protein. The experiment was repeated three times.

    The 1.5 reverse transcription polymerase chain reaction (RT  PCR) detection RhoCmRNA level

    TRIZOL reagent (Gibco) one-step extraction of total RNA the UV spectrophotometer purity and concentration. Take 2μg total RNA was reverse transcribed with AMV reverse transcriptase, PCR amplification RhoC, simultaneous amplification of GAPDH as reference, primers were synthesized by Shanghai Biological Engineering Company. RhoC cited material sequence: 5 ‘ CGGAATTCTCCTCATCGTCTTCAGCAAG  3’ downstream primer: 5 ‘ CGGGATCCCATAAGGGCTGTGCTTGCAG  3’; internal reference gene GAPDH primer sequences for: upstream primer: 5 ‘ ACGGATTTGGTCGTATTGGG  3’; downstream primer: 5 ‘ TGATTTTGGAGGGATCTCGC  3 ‘. PCR conditions: at 94 ° C for 60s, 94 ° C 30s, 59 ° C for 60s, and 72 ° C for 90s, 28 cycles, and then 72 ℃ for 10min. The RhoC amplified fragment of 590bp, GAPDH as 230 bp. PCR products were analyzed by 1% agarose gel electrophoresis, the gel imaging system imaging software Gel Works ID Advanced V4D intensity of each band, the gene expression value of a variety of cellular mRNA absorbance value / internal control absorbance values.

    1.6 Western blot analysis

    The cells were collected, three detergents 50μl, 100μg/ml PMSF, 1μg/ml Aprotinin each 1μl cell lysis, 4 ° C 12000r/min × 15min centrifugation, the supernatant using the Bradford method for protein quantitation. Taken 50μg protein sample by 10% SDS-polyacrylamide gel electrophoresis separation, transferred to a nitrocellulose membrane, 5% skimmed milk 37 ° C closed 1H, RhoC antibody and β  actin antibody were added diluted 1:1000 ( Santa Cruz) 4 ℃ overnight, alkaline phosphatase-conjugated secondary antibody protein hybrid. Images collected after Uvp grab  it Image software, The Gel works ID advanced V4d software for the determination of the absorbance values ​​of the bands, whichever β  actin ratio relative absorbance value.

    1.7 scratches experiments.

    24h after transfection, the cells of the experimental group and the control group were adherent fusion same 20μl Tip head scratches, inverted observed and measured again under the microscope measurements for 24h. The experiment was repeated a total of three groups.

    1.8 three-dimensional culture in vitro angiogenesis test

    I collagen (Sigma) formulated collagen matrix [4  5]. 2mg/ml of collagen type I 24-fold volume of, 10 × EBSS 3-fold volume, 0.1 mmol NaOH, 3-fold volume, DMEM 30-fold volume of FBS to 20-fold volume in 4 ℃ mixed six-well plates per hole add 2ml mixed culture liquid and 12 hours after transfection cells of 1 × 104, 5 days after the cell arrangement and structure of the experimental group and the control group was observed under an inverted microscope. The experiment was repeated three times.

    1.9 statistical methods

    The experimental data are presented as mean ± standard deviation, t-test using SPSS 11.0 software, P <0.05, said the difference was statistically significant.

    2 Results

    The 2.1 human umbilical vein endothelial cells RhoC the expression

    The abundance of mRNA levels, the experimental group and the control group, the expression of RhoC (RhoC / GAPDH) were (12.01 ± 1.72) and (6.81 ± 1.24), the difference between the two groups was statistically significant (P <0.05, n = 3), Figure 1. In the RhoC expression abundance of the protein levels in the experimental group and the control group (RhoC / β  actin), respectively (4.81 ± 0.56) and (3.02 ± 0.32), the difference is statistically significant (P <0.05, n = 3), Figure 2.

    2.2 RhoC affect cell migration of human umbilical vein endothelial cells reactive hyperplasia of the damage will not begin within 24h convergence within 24h stationary monolayer cells to heal injuries can only rely on cell migration. Scratches healing experimental reaction cell migration. [5]. Compare the width of scratches after 0h 24h the width difference 0h width of the experimental and control groups, 24h width of the experimental group than in the control group were narrower, healing percentage (65 ± 6.4)%, respectively ( 54 ± 5.5)% (P <0.05, n = 3), shows that after transfection RhoC, cell migration was significantly enhanced, as shown in Figure 3.

    2.3 RhoC class vascular structures ability of human umbilical vein endothelial cells in vitro to form

    12h after transfection, cells were cultured in three-dimensional medium, 5 days later under an inverted microscope observation, the experimental group and the control group were randomly selected six high-power field of vessel-like structures count, the experimental group (5.01 ± 1.48), the control group (1.72 ± 1.05), the difference was statistically significant (P <0.05, n = 6), as shown in Figure 4.

    3 Discussion

    Angiogenesis (such as inflammation, wound healing, tumor growth and metastasis, etc.) play an important role in many physiological and pathological processes. Either primary tumors or secondary tumors in the growth and spread of the process are dependent on angiogenesis [6]. To shed further light on the the angiogenesis mechanism to application of angiogenesis inhibitors to block tumor metastasis become an important field of cancer research hotspot. The angiogenesis process including matrix degradation, endothelial migration, endothelial proliferation, the process branching morphogenesis and luminal such [7]. This process is affected by many factors, including the extracellular matrix, growth factors, membrane chimeric protein, disintegrin. The signals generated by these molecules leads to changes in the cytoskeleton, causing cell migration, proliferation, budding, lumen, and ultimately the formation of new blood vessels [8]. Wherein the actin and microtubule skeleton may regulate endothelial cell proliferation, to maintain and change the morphology of endothelial cells, to increase its motor activity and play an important role in angiogenesis [9].

    RhoC presence of the combination of the active state and uridine diphosphate (GDP) by guanosine triphosphate (GTP) binding of the non-active state in two forms, to convert between the two so that they can play a similar “molecular switch (molecular switch)" role. RhoC most important function is to regulate the actin cytoskeleton, actin cytoskeleton plays an important role not only in the changes in cell shape, cell motility and phagocytosis, also cells of various life activities such as proliferation, growth and apoptosis play a key role. In eukaryotic cells, RhoC control the reorganization of the actin cytoskeleton. , RhoC allows actin the the protein aggregation tension fibers (stressfiber) to maintain cell morphology and the given cell toughness and intensity; RhoC integrin and related proteins such as fibronectin (FN) gathered into adhesion complexes [10] ; Expression of RhoC and cytoskeletal proteins such as focal adhesion kinase (FAK), paxillin (paxillin), phosphorylation of myosin light chain (MLC) and within adducin (ad2ducin), is directly related to and involved in the regulation of cell motility and migration. RhoC also significantly raised the expression levels of MMPs, and can enhance the activity of MMPs, so the ability to degrade extracellular matrix reinforced, thereby promoting cell migration [11]. Many studies have shown that, RhoC promotes tumor invasion and metastasis. The study found that RhoC expression levels after upward migration of endothelial cells in vitro and significantly enhanced the formation of vessel-like organizational skills. This indicates that RhoC may be provided in the migration of endothelial cells, plays an important role in the process of blood vessel formation. The promotion of angiogenesis may be one of the mechanisms of RhoC promotes tumor metastasis.

    Angiogenesis include a series of complex process, and further study of the the clear vessel formation mechanism will help find effective therapeutic targets, so as to achieve the purpose of anti-metastatic and other vascular proliferative diseases as antiangiogenic.