【Abstract】 Objective To investigate the effect and mechanism of inhibition of the expression of embryonic development-related gene -1 (EDAG  1) the growth of leukemia cell lines. Collection of recombinant plasmid transfected cells package virus supernatant transfected HEL cell lines, inhibition of the EDAG  1 gene expression in cell lines stable puromycin RT  PCR detection of EDAG  1 gene inhibition using the MTT assay turn proliferative capacity of the transfected cells and stably transfected cell lines planted subcutaneously into nude mice tumor is detected. Results inhibition of EDAG  1 gene expression in HEL cell lines. Compared with HEL / negative, HEL / siRNA cell line speed reduced (P <0.05), inoculated subcutaneously into nude mice, tumor growth was significantly slowed (P <0.05). Conclusion silence EDAG  1 gene expression can inhibit the proliferation of leukemia cell lines, prompted EDAG  1 gene may be an effective target for leukemia treatment.

Key words of EDAG  1 was; RNA interference; leukemia; apoptosis

    Effect of siRNA Targeting EDAG  1 Gene in Leukemia Cell Line HEL

    ZHOU Ying1, CHEN Yong2, GAO Zong  xia1, XIAO Min1, FENG Ding  qing1, SHEN Guo  dong1, LING Bin1

    1. Anhui Province Key Laboratory of Molecular Medicine, Molecular Medicine Research Center of Anhui Provincial Hospital, Hefei 230001, China; 2. Department of Oncological Radiotherapy of Anhui Provincial Hospital

    Corresponding Author: LING Bin, E  mail: lingbin.ling @ gmail.comAbstract: Objective The purpose of this study is to explore the effects of silence of EDAG  1 on the growth of leukemia cell line and its mechanism. Methods HEL was infected by the virus supernatant collected from packing cell line transfected by recombinant retroviral vector, the stable cell lines were selected with puromycin. The reduction of EDAG  1 was inspected with RT  PCR; and proliferation was assayed with MTT. The tumor growth of the null mice was analyzed after injection HEL / siRNA, HEL / negative into the skin. Results The stable HEL cell lines with a persistent knockdown of EDAG  1 were established. Comparison with HEL / negative, the proliferation of HEL / siRNA was inhibited significantly (P <0.05), the growth of HEL / siRNA implanted tumor slowed down significantly (P <0.05). Conclusion Inhibition of the expression of EDAG  1 can reduce the proliferation of leukemia cell lines, suggesting that EDAG  1 may be an effective target for the treatment of leukemia.

    Key words: EDAG  1; RNA interfernce; Leukemia; Cell apoptosis

Embryonic development gene  1 (embryonic develop  associated gene 1, of EDAG  1) positioning differentiation associated gene 9q22 hematopoietic system [1], the study found EDAG  1 gene at the same time in a variety of hematopoietic tumors (especially erythroid and megakaryocytic leukemia cells) is highly expressed, may be related to the incidence of tumors of the blood, the gene expression through regulated on activation of nuclear transcription factor NF  κB regulate the proliferation and differentiation of hematopoietic cells [2  4]. In this paper, the efficiency and specificity of RNA interference (RNAi) interference, retroviral vector directly expressed in erythroid leukemia cell line HEL-specific small interfering EDAG  1 gene (small interfering RNA, siRNA), found silence EDAG  1 gene expression can effectively inhibit the proliferation of leukemic cells.

    1 Materials and methods

    1.1 Materials

    1.1.1 Main reagents retroviral vector RNAi  Ready pSIREN  RetroQ, purchased from BD Biosciences, recombinant plasmids of EDAG  1/siRNA cloned into of RNAi  of Ready pSIREN  RetroQ (EDAG  1 gene-specific oligonucleotide sequence 5 ‘ GGATCCGCTCCTAACACATGCCAAGTTTC

    Not AAGAGAACTTGGCATGTGTTAGGAG TTTTTTACGCGTGAATTC  3 ‘), EDAG  1 / negative (formation of the hairpin structure of the non-specific sequences directed cloned into of RNAi  of Ready pSIREN  RetroQ sequence 5’  GGATCCGTGCGTTGCTAGTACCAACTT CAAGAGATTTTTTACGCGTGAATTC  3 ‘) was constructed and identified by the laboratory. The liposome Lipofect2000, total RNA extraction reagent the Trizol puromycin were purchased from Invitrogen Corporation, USA, a small dose of plasmid extraction kit, reverse transcription kit was purchased from Promega Corporation, USA, diethyl pyrocarbonate (DEPC), polybrene ( Polybrene), Chloroquine (Chloroquine) were purchased from Sigma (USA), Taq DNA polymerase was purchased from Sino-American Biotechnology Co., Ltd., on the downstream primers were synthesized by Shanghai Biological Engineering Co., Ltd.. Cell culture medium RPMI 1640, fetal bovine serum were purchased from GIBCO. The the apoptosis detection kit apoAlert the by Annexin V-FITC of apoptosis kit was purchased from American BD clontech Company.

    1.1.2 cell line HEL cells were purchased from Shanghai cells, packaging virus cell line PT67 purchased from BD. The stably transfected transfection of EDAG  1/siRNA build by the chamber of EDAG  1 / negative cell line PT67 packaging virus [1]. The culture medium containing 100mg / L ampicillin and streptomycin, 37 ° C, 5% CO2 humidity culture.

    1.2 Methods

    1.2.1 the recombinant retrovirus infected HEL middle viral cell lines PT67 reached 90% confluence after replaced with complete medium without puromycin, the cell supernatants were collected after 24h 0.45μm membrane filter, and the filtrate was immediately infected. HEL cultured to logarithmic phase, discard dope added 1ml producing virus cell line PT67 cell supernatant filtrate and 1.4μg/ml polybrene, 37 ° C and 5% CO2 in culture 1h repeat infection cultured for 24h, replace the complete medium containing 1.875μg/ml puromycin selective culture medium was changed every 3 to 4 days, about 20 days after the screening of cell survival amplified to full convergence, and later switched to containing 1.875μg/ml purine neomycin complete culture medium and passaged, the cell lines named HEL / siRNA, HEL / negtive.

    1.2.2 RT  PCR The total RNA of the cells was extracted and taken quantitatively good RNA 1μg, according to the steps of the Promega reverse transcription kit synthesized cDNA, and the cDNA product was diluted 5-fold. Taken 5μl template, this template PCR reaction was performed with primers (5 ‘ ACA CCT CAT TCT GAA GAC  3’, 5 ‘ GGG GTA CCT AAA ACA AAA CAT AAC TAT AG  3’) amplified EDAG  1 genes to primers (5’GTGGGGCG CCCCAGGCACCA  3 ‘, 5’  CTCCTTAATGTCAC GCACGATTT  3) amplification of the housekeeping gene β  actin as an internal control. PCR amplification system to a 94 ° C 1min, 50 ° C 1min, 72 ° C 1min, 30 cycles, 72 ℃ 7min extension, amplified product is detected in a 1% TAE agarose gel electrophoresis.

    1.2.3 Cell proliferation assays Cells were harvested and counted with a 10% serum-containing RPMI1640 culture medium made from the cell suspension, and adjusting the cell concentration and inoculated into 96-well culture plate, each well 200μl, cell number of 1 × 104. Adding 30μl MTT (5mg/ml) were cultured 24,48,96 h cultured for 4h, after centrifugation to remove the supernatant was added 150μl DMSO oscillation 20min using a microplate reader to detect the 570 nm wavelength light absorption value, taking the mean of 4 holes .

    Nude mouse tumor experiments 1.2.4 the HEL / siRNA, HEL / negative cells were inoculated into Balb / c nude mice subcutaneously, each nude mice inoculated cells 2 × 106, the injection volume of 0.1 ml of each of five nude mice . Weekly Tumor growth conditions after injection, tumor volume was measured, respectively, in the first day 10,20,30,40: The 3-direction of the diameter of the tumor mass was measured with a vernier caliper, respectively denoted as a, b, c, tumor volume was calculated: V = abc × 0.4. Nude mice after the cells were seeded into a tumor volume were compared.

    1.2.5 Statistical Methods Data were analyzed using statistical software SPSS10.0, the experimental data to ± s, the statistical significance of the differences between the two groups using paired t test.

    2 Results

    2.1 siRNA the the HEL cell strains of EDAG  1 gene expression inhibition assay

    RT  PCR detection EDAG  1 mRNA expression, compared with the control group, the HEL / siRNA cell lines EDAG  1 gene expression was inhibited, the inhibition rate of 76.5%, as shown in Figure 1.

    2.2 siRNA interference of EDAG  1 gene expression of the proliferation of the HEL cell line

    Compared with the control group, HEL / siRNA cell lines in the first four days, the proliferation rate of the first six days of much slower (P <0.05), as shown in Figure 2.

    2.3 nude mice experiments

    Figure 2 Interference of EDAG  1 gene expression in the cell lines HEL cell line proliferation vaccination days 10,20,30,40 measuring tumor volume, HEL / negative inoculated tumor, HEL / siRNA the inoculated tumor volume shown in Figure 3, display HEL / siRNA vaccination slow tumor growth significantly (P <0.05).

    3 Discussion

    Red blood cells and megakaryocytes in the development process may be derived from the same kind of hematopoietic stem cells, are by GATA-1 and GATA  2 expression is closely related to its characteristic surface markers (the erythrocyte GlyA, megakaryocytic cells CD41/CD42/CD61) expression mutual crossover phenomenon exists; specific factor stimulation, the erythrocytes can differentiate into megakaryocytes, giant cells can also be transformed into red blood cells [5]. EDAG  1 gene GATA  signal transduction pathways downstream gene GATA-1 erythroid, megakaryocyte growth and differentiation in the maturation process of key transcription factors [6], therefore, presumably EDAG  1 gene is likely to play in the development of red blood cells, megakaryocytes important role worthy of further study.

    The results of this study showed that the inhibition of EDAG  1 gene expression can effectively inhibit the proliferation of erythroid leukemia cell line HEL tumor in vivo experiments show that the low expression of EDAG  1 gene HEL nude mice tumor growth slowed down. That EDAG  1 gene is involved in the regulation of erythroid leukemia cell proliferation, and found that high expression of HEL cells EDAG  1 gene structure of the coding region of the gene is not a base point mutations, insertions or deletions, Southern blot nor found EDAG  1 genome rearrangement and amplification phenomena [4]. Inferred EDAG  1 expression is likely to be caused by abnormal regulation.

    The EDAG  1 gene proliferation may occur in the G0/G1 phase of the regulation [7]. An LL, inhibition of K562 cell line of EDAG  1 gene expression found that the expression levels of p21, Bcl  2 and c  myb expression is reduced that EDAG  1 gene may be through the regulation of p21, of c  myb expression role in the G0/G1 phase, regulation of leukemia cell proliferation [8]. The study also found that EDAG  1 may be through the inhibition of NF  κB activation affect the expression of IL  8, the regulation of cell proliferation [9]. Will be involved in the abnormal expression of IL  8 and NF  κB differentiation of hematopoietic cells, leukemia cell biology behavior change [10]. Therefore, EDAG  1 gene may be one of the effective target for leukemia treatment.