Abstract Objective To investigate the relationship between survivin alternative splicing variant expression and clinicopathological parameters of colorectal cancer, reveals a role in the development of colorectal cancer and clinical significance. Methods RT  PCR combined with immunohistochemistry the survivin variety of splice variants expression in colorectal cancer and adjacent tissues, also of survivin splicing variants of survivin  2B and survivin  ΔEx3 expression and clinicopathological The information made the correlation analysis. The results colorectal cancer tissues and adjacent tissues expressed survivin, and immunohistochemistry confirmed; survivin  2B expression in cancer tissue, and survivin  ΔEx3 mainly expressed in cancer tissue and tumor metastasis-related. Balanced relationship between the conclusions the survivin different variants expression may play an important role in the occurrence and development of tumors.

Key words】 survivin gene; splice variants; colorectal cancer; RT  PCR

Correlation between survivin Expression and Clinicopathological Factors in Colorectal Cancers

    FU Wen  rong1, ZHANG Qin1, CHENG Zheng  jiang2

    1. Department of Pathology, Xiangfan Hospital, Tongji Medical College, Huazhong University of Science and Technology, Xiangfan 441021, China; 2. Department of Clinical Medicine, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology

    Corresponding Author: CHENG Zheng  jiang, E  mail: zjcheng11@yahoo.com.cnAbstract: Objective To investigate the expression of survivin variants and their relationship to each other as well as to clinic pathological factors in colorectal cancer. Methods survivin variant specific RT  PCR was developed to analysis their expression in 67 paired cancer and para  cancer tissues, and the expression of the wildtype survivin at the protein level was further verified by immunohistochemistry. Results All the cases tested expressed survivin mRNA, and immunohistochemistry obtained similar finding. The nonantiapoptostic survivin  2B was dominantly expressed in para  cancer tissues, whereas the antiapoptostic survivin  ΔEX3 was more frequently detected in cancer tissues. The expression of survivin  ΔEX3 mRNA was significantly associated with tumor metastasis. Conclusion The balance between antiapoptostic survivin iso  forms and nonantiapoptostic ones may play an important role in tumor genesis and tumor progression.

    Key words: survivin; Splice variants; Colorectal cancer; RT  PCR

survivin gene inhibitor of apoptosis proteins (IAP) in a unique member of the dual function of cell cycle regulation and inhibition of apoptosis, it is expressed in almost all of the tumor tissue but not in normal tissue expression [1] . A large number of clinical data indicate that survivin overexpression and tumorigenesis and metastasis. survivin is 4 exon splicing transcripts encoding 142 amino acids. The two major alternative splicing variant survivin  2B and survivin in of  ΔEX3 [2]. the survivin  2B on the basis of the survivin 69bp of exon 2B, encoding 165 amino acid exon 2B insert interference of the BIR domain of survivin  2B anti-apoptotic activity was significantly decreased. survivin  ΔEX3 is selected to cut off outside the exon 3, and causing the exons 4 area change of the coding sequence, the termination codon to the 3 untranslated region, encoding 137 amino acids, resulting in enhanced anti-apoptotic activity . Designed survivin splice variant specific primers used to detect its expression in colorectal cancer, while analysis of the correlation between various variants and their expression levels between the clinical and pathological data.

    1 Materials and methods

    1.1 Materials

    1.1.1 cases, source of 67 cases of colorectal cancer diagnosed by pathology Xiangfan Hospital Affiliated to Tongji Medical College, Huazhong University of Science and Technology, including 38 males and 29 females; average age of 57 (34 to 77 years), patients with preoperative without any chemotherapy or radiotherapy. Part of the surgical cut cancer tissue and its paired adjacent tissues (away from cancer 2 ~ 3cm) The frozen for transfer to -80 ℃ cryogenic refrigerator to RNA extraction. Another part of the corresponding specimens after routine formalin-fixed, paraffin-embedded sections for pathological and immunohistochemical analysis. TNM program clinical stage Ⅰ 14 cases, Ⅱ 19 cases, Ⅲ of 24 cases and 10 cases of stage Ⅳ.

    1.1.2 Main reagents and instruments DNA polymerase buffer, Mg2 +, dNTPs and reverse transcriptase kit was purchased from Promega Corporation, RNA extraction reagent Trizol were purchased from Invitrogen Corporation, 20 × SYBR Green Ⅰ purchased from OPEC of survivin polyclonal antibody SABC (streptavidin biotin  biological Su  peroxidase complex) color kit was purchased from Wuhan Boster. LightCycler real-time PCR analyzer (Roche).

    1.1.3 primer design and synthesis software primer3 (http://www  genome.wi.mit.edu / cgi  bin/primer/primer3.cgi) primers were designed, and its specificity confirmed by searching GenBank. Effectively distinguish between different splice variants, we will design of survivin the  2B and survivin  ΔEX3, a primer at the junction of exon and exon. 5 ‘ AACTGGCCCTTCTTGGA  3’ and 5 ‘ TCGTCATCTGGCTCCC  3’ amplification the total survivin (146bp); 5 ‘ ATGACGACCCCATGCAAAG  3’ and 5 ‘ GGTGGCACCAGGGAATAAAC  3′ for amplification of survivin  ΔEX3 (173 bp) ;, 5’- GCGGATCACGAGAGAGGA  3 ‘and 5’  TCTCCGCAGTTTCCTCAAAT  3 ‘for amplification of survivin of  ΔEX  2B (179 bp). 5 ‘ GAAGGTGAAGGTCGGAGTC  3’ and 5 ‘ GAAGATGGTGATGGGATTTC  3’ internal control for amplification of GAPDH (226bp). All above primers were synthesized by Invitrogen Shanghai.

    1.2 Methods

    1.2.1 cDNA synthesis Trizol method tissue total RNA, reverse transcription kit from Promega manual synthesis of cDNA The cDNA was diluted to 100 μl of nuclease-free distilled water and stored at -20 ° C.

    1.2.2 Real-time fluorescence RT  PCR method to detect the expression of survivin mRNA level reaction conditions of 95 ℃ 45s denaturation at 95 ° C 10s denaturation, 58 ℃ 10s, 72 ℃ 20s of the annealing extension, 45 cycles, fluorescence acquisition at 72 ℃ 45s during the extended signal. Dilution series (1:40 to 1:47) of the target gene and the endogenous control gene cDNA used for the amplification efficiency and sensitivity of the response to the evaluation. After the end of the amplification reaction is added to do melt chain curve and agarose gel (3.0%) electrophoresis analysis to verify the specificity of the reaction. The purpose of the evaluation of the level of gene expression using E  method [3], and the results of the relative copy number (the ratio of the internal control GAPDH mRNA in target gene mRNA) expressed.

    1.2.3 Immunohistochemical detection of reference the Boster kit instructions. One cases of survivin expression in greater than 50% of the Phase III colon slices of tumor cells used as a positive control, negative control without anti.

    1.2.4 Statistical Methods

    All data on the software SPSS11.0 analysis and processing. Measurement data comparison between the two groups using the Wilcoxon test, the rate of the chi-square test was used to compare the relationship between each splice variant using Spearman correlation analysis. The two-tailed P <0.05 considered statistically significant.

    2 Results

    2.1 survivin and its splice variants of mRNA in cancer and paraneoplastic tissues

    Pair of 67 cases of cancer and adjacent tissues can be detected survivin. Next to the cancer tissue and cancer tissue expression relative copy number (mean ± SD) (2.317 ± 1.564) and (0.865 ± 0.776), shown in Figure 1, the cancer tissue survivin / GAPDH ratio was significantly higher than in adjacent Organization (P = 0.003), survivin  ΔEX3 expression in cancer tissues, survivin  2B is mainly expressed in cancer tissue. the survivin  2B and survivin  ΔEX3 cancer tissues positive rates were 23.9% (16/67) and 76.1% (51/67), and in adjacent tissues, the positive rate was 56.7% (38/67) and 32.8% (22/67).

    2.2 Immunohistochemical detection of the expression of survivin protein and survivin mRNA expression between

    survivin protein expression in the cytoplasm. Overall, the cancer tissue strong expression of adjacent tissues showed moderate expression, as shown in Figure 2. Unexpectedly, three cases of cancer tissue expression of survivin strength and their corresponding cancer adjacent tissues have been confirmed on the mRNA expression levels in 67 cases, and their corresponding cancer tissue mRNA / cancer adjacent tissue mRNA <2.0. 2.0设定为强表达。">As in all cases between survivin expression was high heterogeneity, cancer tissue mRNA / cancer adjacent tissue mRNA> 2.0 is set to strong expression. This judgment based on our total survivin strong expression was found in 89.6% (60/67) of cases.

    2.3 survivin and its splice variants with clinicopathological parameters between

    As can be seen from Table 1, in addition to of survivin  ΔEX3 and tumor metastasis-related, survivin and its various There was no statistical correlation between the splice variants and age, gender, tumor grade and clinical stage (P 0.05)。">> 0.05).

    3 Discussion

    The results showed that survivin not only strong expression in cancer tissues but also have a moderate intensity of expression in all paracancerous organizations Suga et al [4] The expressions of survivin mRNA detected only in 59.6% (31/52) of the corresponding normal tissue. One reason may be our select tumors neighbor table 1 survivin and its splice variants of the relationship between the body and clinicopathological parameters nearly organization they choose far from “normal" tissue as control, Again taken from cancer patients paraneoplastic may have already occurred at the molecular level changes to high expression of Survivin. It needs to be noted that the overall cancer tissue expression of survivin stronger than adjacent tissues (P = 0.003), but the expression levels between individuals are heterogeneous, there are still some cases of cancer tissue survivin expression levels lower than the corresponding paraneoplastic organization. That survivin expression in tumor occurrence and development process of the mechanism of the disorder has complexity.

    Produce a variety of alternative splicing variants of survivin expression and functional complexity. Observed before survivin  2B, and survivin  ΔEX3 mainly expressed in malignant tumors differ from the results, we found that with the adjacent tissues to cancerous tissues of survivin  2B positive expression rate reduction (56.7% to 23.9%), survivin  ΔEX3 positive expression rate was significantly on the rise (32.8% to 76.1%). This implies a distinct role in the carcinogenesis process of survivin  ΔEX3 and of survivin  2B plays. In fact, survivn  ΔEX3 lost outside exon 3, but still retains its anti-apoptotic activity. The co-expression experiments confirmed of survivin  ΔEX3 with wild-type survivin forms a heterodimer complex and raised the mitochondria synergistic mitochondria-dependent anti-apoptotic function [5]. the survivin  2B can weaken the anti-apoptotic activity of survivin in tumors sensitive to chemotherapy drugs, is considered to be the natural antagonist of survivin. the survivin  2B may through competition with survivin  ΔEX3 combined the survivin or direct form of combination with survivin  ΔEX3 play its antagonism. The expression of survivin  2B in tumor tissue will result in severe cut from the same hnRNA precursor wild-type survivin and survivin  ΔEX3, the relative increase. Apparently anti-apoptotic splice variants in tumor tissue and promote a serious imbalance between apoptotic splice variant expression levels, which may be an important mechanism of tumorigenesis and development.

    Despite survivin overexpression in colorectal cancer, but there are different degrees of expression in the cancer tissue. Gianani et al [6] reported using immunohistochemical methods in the colon of normal, hyperplastic, precancerous lesions and cancer tissues can be detected by the presence of survivin. The these tips survivin can not be used as a colon cancer tumor markers, but we found that survivin splice variant has a different mode of expression between normal tissue and tumor tissue and benign and malignant tumors of survivin splice variants might tumorigenesis development plays an important role.