[Abstract] Objective To detect lung cancer serum DNA content and the expression levels of hTERT, seeking minimally invasive, high sensitivity and specificity of the detection methods, provide new targets for the early diagnosis of lung cancer. Methods 41 patients with pathologically confirmed lung cancer patients and 22 normal subjects as controls. The beads suspension extracted serum DNA content; nested PCR amplification of serum hTERT fragment measured gray scale. Results in patients with lung cancer, the DNA content of normal human serum were 33.464 and 18.420, lung cancer serum DNA concentration was significantly higher than the normal control group (P <0.01). Nested PCR amplification serum hTERT fragment measured grayscale than as a diagnostic cut-off point, draw the ROC curve, AZ = 0.852, 95% confidence interval of the AZ CI (0.750,0.953, P = 0.000), that serum hTERT For the diagnosis of lung cancer with moderate accuracy. Diagnostic cut-off point = 0.4, Kappa = 0.477, (P <0.01) was statistically significant, in good agreement with the pathological diagnosis. Conclusion peripheral blood DNA and hTERT has good sensitivity and specificity in the diagnosis of lung cancer, and may become a new means of detection for early diagnosis of lung cancer.

【Key Words】 lung; DNA; of hTERT; genetic diagnosis

 Application of Serum DNA and hTERT in Diagnose of Lung Cancer

    WANG Jing, LV Ke  jie, ZHU Guang  chang

    Department of Throcic Surgery, Beijing Friendship Hospital Affiliated of the Capital University of Medicine Sciences, Beijing 100050, ChinaAbstract: Objective This study designed to assess a quantitative molecular assay of serum DNA and the expression of hTERT in patients with lung cancers to explore a novel noninvasive approach, elevating the sensitivity and specificity in diagnose of lung cancer. We conducted the clinical study to provide a new marker for earlier lung cancer detection. Methods Forty  one informed patients with lung cancers and 22 healthy persons were included as control. DNA was extracted from serum samples with MaGaZorb DNA Mini  Prep Kit and quantificated, then hTERT sequences was amplified by nested PCR using gene primers. Results Mean concentration of serum DNA between patients with lung cancers and healthy persons was 33.464μg/ml and 18.420μg/ml respectively . Concentration of free circulation DNA in patients with lung cancers was higher than the other group (P <0.01). The area under the ROC curve by ratio of gray scale was 0.852 (95% CI, 0.750 to 0.953). Amplification of serum hTERT by nested PCR was a approach with moderate veracity to detect lung cancers. Meanwhile, it had a good coherence with pathology (Kappa = 0.477, P <0.01). Conclusion The level of free circulating DNA in patients with lung cancers was higher than healthy persons . Amplification of serum hTERT by nested PCR was a approach with high sensitivity. So it may be a new, noninvasive approach for early detection of lung cancers.

    Key words: Lung cancer; DNA; hTERT; Gene diagnosis

 Studies have shown that DNA levels in the blood of patients with malignant cycle is not only far higher than normal, but also has the DNA of tumor characteristics change, and consistent with the expression of the same gene in the tumor tissue [1]. Telomerase expression in immortalized cell lines and malignant tumors derived cell lines were positive expression [2], and not in normal cells. Through analysis of lung cancer patients DNA extraction, nested PCR amplification serum hTERT (human telomerase reverse transcriptase), to study the expression levels will provide important clues to the early diagnosis of lung cancer, and lung cancer treatment of postoperative monitoring and prognosis provided an important basis. To this end, we examined the DNA level in peripheral blood of patients with lung cancer and hTERT concentration, to explore the peripheral blood DNA and hTERT concentration detection diagnosis of lung cancer.

    1 Materials and Methods

    1.1 The object of study

    Select Thoracic Surgery cytology or pathology examination confirmed the initial treatment of patients with lung cancer, 41 cases in 2005; adenocarcinoma in 19 cases, 15 cases of squamous cell carcinoma, squamous and adenocarcinoma in 2 cases, 3 cases of small cell carcinoma, large cell carcinoma, 2 cases ; 17 males, 24 females; aged 18 to 75 years old, with an average age of 59 years; tumor stage according to the World Health Organization (WHO) standard: Ⅰ 14 cases, Ⅱ 18 cases, Ⅲ a period of nine cases. And randomly selected healthy subjects were compared in 22 cases. All objects in the peripheral blood leukocytes, normal liver and kidney function without chronic hepatitis and autoimmune diseases.

    1.2 Methods

    The 1.2.1 experimental reagents (1) the agarose, TaqDNA polymerase; (2) Kit: bead purified DNA kit (BSCOSS2), Beijing Bai billion new Science and Technology Co., Ltd.; TaqPCR kit (KT101  01), Beijing days for Time Inc.; the of DNA Marker1 (MD101-01), Beijing company Tianweishidai; PCR primers, Beijing SBS Genetech Limited; (3) PCR primer design and synthesis of the: of hTERT nucleotide sequence targeted at 5p15.33 outside heavy primer 343bp (2 647 ~ 2 989), within the heavy primers 326bp (2 662 ~ 2 989, GenBank assession number AF015950), application Primer3 analysis software design, Beijing SBS Genetech Co., Ltd..

    hTERT  up (P1): 5 ‘ GCGTTTGGTGGATGATTTCT  3’

    hTERT  down (P2): 5 ‘ CAAGACCCCAAAGAGTTTGC  3’

    hTERT  up (P3): 5 ‘ TTTCTTGTTGGTGACACCTC  3’

    hTERT  down (P4): 5 ‘ CAAGACCCCAAAGAGTTTGC  3’

    1.2.2 Major equipment DNA Thermal Cycler, Perkin Elmer Cetus, USA; UV gel imager Chemi Doc, Italy Bio RAD; UV-visible spectrophotometer Ultrospec3100, Biochrom Ltd; desktop centrifuge at low temperature, Shanghai Anting Scientific Instruments The plant; cryogenic refrigerator ULT1386 ​​ 3  V30, United States REVCO; electrophoresis instrument EPS300 Shanghai TIANNENG Technology Co., Ltd..

    The 1.2.3 experimental method (1) serum DNA extraction and concentration determination. 3ml blood samples were placed in a red tube centrifuged (if not timely treatment, can be stored for 4 ℃ refrigerator for no more than 6 hours) – taken after centrifugation, the upper serum placed in 1.5ml centrifuge tubes, -80 ℃; Serum samples were extracted experimental object, MagaZorb DNA Mini  Prep Kit reagents at room temperature, take 12μl PK (protease) into 1.5ml microcentrifuge tube tube take on 120μl serum Move, and into 120μl Lysis Buffer and mix 15 seconds, 56 ° C warm bath 10min; Add 300μl Binding Buffer first tube, adding 12μl mix of MagaZorb of reagents, mix well, at room temperature bath 10min microcentrifuge tube placed on a magnetic rack adsorption of DNA binding beads, the supernatant was discarded spare; adding 600μl Wash Buffer to the microcentrifuge tube mix well put in the magnet. adsorption beads, the supernatant was removed, washed repeat; Add 20μl Elution Buffer to the microcentrifuge tube placed on a magnetic rack thoroughly mixed after 10min adsorption beads carefully the supernatant was transferred to a clean microcentrifuge tube and stored, -20 ℃; 2.5μl DNA product was dissolved in 500μl of deionized water, and diluted 200 times, taking 90μl of deionized water into the cuvette as a control, into the ultraviolet visible spectrophotometry photometer the standardized colorimetric frame; wipe cuvette shifted to 90μl diluted DNA product measured concentration values ​​recorded. Each sample was measured three times, and takes an intermediate value, the DNA concentration (μg / ml) = measured concentration of DNA / 6; (2) nested PCR amplification of hTERT. First amplification, the PCR amplification system (25 μl): 10 × Reaction Buffer2.5μl; Mixture. MM dNTP (2.5 mmol / l each) 2μl; Taq (2.5u/μl) 0.35μl; the GAPDH  up (10μmol / L) 1 μl of; GAPDH  down (10μmol / l) 1 μl; DNA product 2μl; ddH2O16.15μl

    Reaction system plus 20μl of paraffin oil.

    Reaction conditions: 94 ° C denaturation 3min; denaturation at 94 ° C for 30 s; 52 ° C annealing 1min; extending at 72 ° C for 1min; 20 cycles of 72 ℃ for 10min

    The first PCR product was diluted 100 times, taking 4μl for the second amplification.

    Second amplification, the PCR amplification system (25μl): 10 × Reaction Buffer 2.5μl; dNTP Mixture (2.5mmol / l each) 2μl; Taq (2.5u/μl) 0.3μl; GAPDH  up (10μmol / l) 1μl In; the GAPDH  down (10μmol / l) 1μl; first amplification product (1%) 4μl; ddH2O14.2μl

    Reaction system plus 20μl of paraffin oil. Reaction conditions: denaturation at 94 ° C for 3min; denaturation, 94 ° C, 30s; annealing, 52 ° C, 1min; extend, 72 ° C, 1min; 26 cycles of 72 ℃ for 10min

    The end of the reaction, taking 7μl PCR product was observed in the electrophoresis in a 1.25% agarose gel (containing 0.5% ethidium bromide), UV lamp, UV gel imager scan imaging. Each are equipped with positive and negative controls. The gray-scale imaging the Photo application of image analysis processing system scan analysis of integrated optical density value of the measured area.

    1.3 statistical methods

    The results were analyzed by SPSS11.5 statistical analysis software, measurement data described as mean ± standard deviation, one-way ANOVA; count data constitutes described, chi-square test. ROC curve (receiver operating characteristic curve), calculate the area under the curve, both consistency Kappa test, P <0.01, the difference was statistically significant, the difference was not statistically significant 0.010.05.

    2 Results

    2.1 Determination of DNA content

    Experimentally 63 serum samples of DNA (41 cases of lung cancer group and normal control group, 22 cases), and UV-visible spectrophotometer concentration: lung cancer group mean 33.463 7μg/ml in the standard deviation 9.45118,95% CI (30.48,36.45 0.05,本组数据近似正态分布。">) μg / ml, two-sided test, P = 0.333> 0.05, the set of data approximate a normal distribution. Normal control group mean 18.4200μg/ml, standard deviation 5.56294,95% CI (14.44,22.40) μg / ml, two-sided test, P = 0.999, the set of data approximate a normal distribution.

    Two sets of data SPSS11.5 statistical analysis software, one-way ANOVA (P <0.01), the difference was statistically significant, and thus can be considered to lung cancer serum DNA content was significantly higher than the normal control group.

    2.2 serum hTERT expression detection

    First verify through the housekeeping gene GAPDH DNA quality, using dual primers P1  P2, P3  P4 amplified by nested PCR of hTERT, 1.25% agarose gel electrophoresis after photographic. Experiment with extract lung tissue DNA as a positive control, ddH2O as negative control, gray-scale measurement of the photo in the strip after 63 subjects were serum DNA amplification and amplified with the corresponding housekeeping gene GAPDH bands gray compared to the value obtained the hTERT gradation ratio, are shown in Table 1. Table 1 hTERT amplification gradation than the measurement result is split into 2 × 2 table, the calculated the FPR value (false-positive rate) and TPR values ​​(true positive rate – Sensitivity) constitute a pair, namely ROC working point, see Table 2. Table 2 hTERT ROC operating point of the ROC curve area under the AZ = 0.852, AZ 95% confidence interval CI (0.750,0.953, P = 0.000), serum hTERT that the diagnosis of lung cancer with moderate accuracy. Further take different grayscale ratio as the cut-off point, and its diagnostic sensitivity, specificity analysis, and to calculate the Kappa value. When the diagnostic cutoff point of 0.2, Se = 82.93%, Sp = 68.18%, Kappa = 0.456; When the diagnostic cut-off point for 0.4 Se = 75.61%, Sp = 86.36%, Kappa = 0.477; When the diagnostic cut-off point of 0.6 Se = 65.85%, Sp = 95.45%, Kappa = 0.416; diagnostic cut-off point of 0.8 Se = 56.10%, Sp = 100%, Kappa = 0.367

    Be seen on analysis and diagnostic cut-off point = 0.4, Kappa = 0.477, sensitivity Se = 75.61%, specificity Sp = 86.36%, the positive predictive value of PV + = 31/33 = 93.94%, negative predictive value, PV-= 10 / 29 = 34.48%; sensitivity, specificity, Kappa higher than other diagnostic cut-off point, Kappa = 0.477 when P <0.01, the difference was statistically significant, its consistency with the diagnostic gold standard – pathological diagnosis better. Nested PCR serum hTERT lung cancer diagnosis.

    3 Discussion

    In today’s medical condition, how to early detection of malignant tumors is to improve the efficacy of the key. The ideal detection method should be based noninvasive or minimally invasive method is simple to adapt to population screening results sensitive specificity. Therefore, the detection and study of peripheral blood tumor indicators become popular. CEA (carcinoembryonic antigen), CYFRA21-1 (cytokeratin fragment), NSE (neuron specific enolase) [3] has been widely used in the detection of lung cancer clinical. But in addition to NSE sensitivity in small cell lung cancer from 60% to 80% [4], and the remaining sensitivity are less than 50% [5]. The experiment: the concentration of serum DNA of patients with lung cancer were significantly higher than the normal population; lung cancer patients with serum hTERT significantly higher than in the normal population, the diagnostic cut-off point = 0.4, in good agreement with the diagnostic gold standard – pathological diagnosis. Peripheral blood DNA and hTERT has clinical value in the diagnosis of lung cancer, and provides a new means for early diagnosis and screening of lung cancer, its detection technology is mature, the method is simple, easy to grasp; painful subjects is small, low cost, easy to accept for population screening, and can batch testing; better consistency with the pathological diagnosis. Therefore, the indicator has a good application prospect worthy of further research and promotion.