Abstract Function of CD4 + CD25 + Treg and Effecter Cells of Mice with Lewis Lung Cancer Were Influenced by CTX and BCG Therapeutic Alliance

LI Xin1, CUI Yong  sheng1, 2, LIU Bai  nan1, LI Yi1

1.Department of Immunology, School of Basic Medical Sciences, Jilin University, Changchun 130021, China; 2.Department of Thoracic Surgery, First Hospital, Jilin University

Corresponding Author: LI Yi, E  mail: yilili19@yahoo.com.cnAbstract: Objective To study the function of CD4 + CD25 + Treg and effecter cells of mice with Lewis lung cancer were influenced by CTX and BCG therapeutic alliance, investigate the relationship of CD4 + CD25 + Treg and the tumor, and provide experiment evidence for the tumor immunotherapy. MethodsThe models were established by injected CTX (25mg/kg) and after 7 days injected subcutaneously to the right axilla of C57BL / 6 mice with subculturing Lewis lung cancer cells and BCG (12.5mg/kg). The dynamic changes of tumor volume were observed. The changes of number of CD4 + CD25 + Treg and the expression of Foxp3 in spleen were detected by flow cytometer and semi  quantitative RT  PCR. The changes of T lymphocyte proliferation and killing function spleen were detected. Results The tumor volumes grew more slowly in CTX and BCG therapeutic alliance group than in the tumor group. The number of CD4 + CD25 + Treg in spleen of mice was lower in therapeutic alliance group than in the tumor group (P <0.05). The expression of Foxp3 mRNA in spleen lymphocyte was significantly lower in therapeutic alliance group than in the tumor group (P <0.05). The changes of T lymphocyte proliferation in spleen were significantly higher in therapeutic alliance group 0.05). Conclusion After CTX and BCG therapeutic alliance, the number of">than in the tumor group (P <0.05). The changes of T lymphocyte killing function in spleen was not significantly lower in therapeutic alliance group than in the tumor group (P> 0.05). Conclusion After CTX and BCG therapeutic alliance, the number of CD4 + CD25 + Treg and the expression of Foxp3 mRNA in spleen of mice with Lewis lung cancer decreased, and enhanced the immune response to tumor, this may delay the growth of the tumor.

Key words: CTX; Treg; Foxp3; Tumor immunity

Key words CTX; Treg; Foxp3; tumor immune

Function of CD4 + CD25 + Treg and Effecter Cells of Mice with Lewis Lung Cancer Were Influenced by CTX and BCG Therapeutic Alliance

    LI Xin1, CUI Yong  sheng1, 2, LIU Bai  nan1, LI Yi1

    1.Department of Immunology, School of Basic Medical Sciences, Jilin University, Changchun 130021, China; 2.Department of Thoracic Surgery, First Hospital, Jilin University

    Corresponding Author: LI Yi, E  mail: yilili19@yahoo.com.cnAbstract: Objective To study the function of CD4 + CD25 + Treg and effecter cells of mice with Lewis lung cancer were influenced by CTX and BCG therapeutic alliance, investigate the relationship of CD4 + CD25 + Treg and the tumor, and provide experiment evidence for the tumor immunotherapy. MethodsThe models were established by injected CTX (25mg/kg) and after 7 days injected subcutaneously to the right axilla of C57BL / 6 mice with subculturing Lewis lung cancer cells and BCG (12.5mg/kg). The dynamic changes of tumor volume were observed. The changes of number of CD4 + CD25 + Treg and the expression of Foxp3 in spleen were detected by flow cytometer and semi  quantitative RT  PCR. The changes of T lymphocyte proliferation and killing function spleen were detected. Results The tumor volumes grew more slowly in CTX and BCG therapeutic alliance group than in the tumor group. The number of CD4 + CD25 + Treg in spleen of mice was lower in therapeutic alliance group than in the tumor group (P <0.05). The expression of Foxp3 mRNA in spleen lymphocyte was significantly lower in therapeutic alliance group than in the tumor group (P <0.05). The changes of T lymphocyte proliferation in spleen were significantly higher in therapeutic alliance group 0.05). Conclusion After CTX and BCG therapeutic alliance, the number of">than in the tumor group (P <0.05). The changes of T lymphocyte killing function in spleen was not significantly lower in therapeutic alliance group than in the tumor group (P> 0.05). Conclusion After CTX and BCG therapeutic alliance, the number of CD4 + CD25 + Treg and the expression of Foxp3 mRNA in spleen of mice with Lewis lung cancer decreased, and enhanced the immune response to tumor, this may delay the growth of the tumor.

    Key words: CTX; Treg; Foxp3; Tumor immunity

CD4 + CD25 + regulatory T cells (regulatory T cell, Treg) cell populations having the role of immune regulation (or immunosuppression), CD4 + T cells from 5% to 15% [1]. Discovered in recent years have immunomodulatory function of CD4 + CD25 + Treg cells while maintaining the stability of self-tolerance and immune to some mechanism for suppression of the immune response of the immune system against tumor cells, and thus affect the occurrence and development of tumor 2].

    Cyclophosphamide (CTX) has a cytotoxic effect on tumor cells, recent studies have shown that CTX can also affect the function of the immune system exerts its anti-tumor function [3  4]; Guerin (BCG) has to stimulate the immune system of the tumor the immune response, and promote the role of the body to resist tumor. This article CTX United BCG treatment of mice with Lewis lung, observation of CD4 + CD25 + regulatory T cells change to provide experimental evidence for tumor immunotherapy.

    1 Materials and methods

    1.1 Materials

    CTX Jiangsu Hengrui Medicine Co., Ltd. products; BCG Zhejiang Wanma Pharmaceutical Co., Ltd.; PE  anti  CD4 + and FITC  anti  CD25 + antibody was purchased from Gene Company; Trizol reagent was purchased from GIBCO; AMV reverse transcriptase , RNasin Ex Tag DNA polymerase TaKaRa company products; MTT was purchased from Sigma; the microtiter detector 550 is BIORAD company’s products; flow cytometry BD Company products.

    1.2 Experimental animals and groups

    Experimental Animal Center of Jilin University inbred C57BL / 6 mice, 32, male, weight 18 ~~ 22g, 4 to 6 weeks of age. (N = 8) were randomly divided into a control group, tumor group, CTX group and combination therapy group. Of Lewis lung carcinoma cells with 1 × 106 / seeded in the mouse right axillary subcutaneous preparation of Lewis lung tumor group model; mice injected with CTX (25mg/kg) 7 days after the inoculation of Lewis lung carcinoma cells 1 × 106 / mice right axillary subcutaneous preparation the CTX alone treatment group model; mice injected with CTX (25mg/kg) 7 days intraperitoneal injection the BCG (12.5mg/kg), inoculated with Lewis lung cancer cells of 1 × 106 / mouse right axillary subcutaneous preparation combined therapy group model; control group for right mouse the axillary subcutaneous injection of the same amount of saline.

    Of 1.3 observations indicators and methods

    1.3.1 tumor volume change since the first 7 days, was measured with a vernier caliper every 3 days each mouse underarm tumor length (L) and shorter diameter (W) to calculate the tumor volume: V = LW2 of / 2, with Steel formula.

    1.3.2 Spleen CD4 + CD25 + Treg cell levels of determination were sacrificed by cervical dislocation of mice, preparation spleen cell suspension, Tris  NH4Cl swelling of red blood cells, take the 1 × 106 cells (100μ l volume) joining PE  anti  CD4 + and FITC  anti  CD25 + antibody, CD4 + CD25 + of Treg cell numbers detected by flow cytometry.

    1.3.3 spleen expression of Foxp3 mRNA measurement was extracted using Trizol reagent spleen tissue in the total RNA, and a reverse transcription reaction. The the mouse Foxp3 primer sequences upstream 5 ‘ CAGCTGCCTACAGTGCCCCTAG  3’, downstream 5 ‘of  CATTTGCCAGCAGTGGGTAG  3’, amplified fragment size of 382bp, reaction conditions at 94 ℃ for 30 s, 58 ° C renaturation 30s extension at 72 ° C for 30s further extend 72 ° C for 10 min, after 36 cycles. Select β  actin as an internal reference, and 5 μl of PCR product with a 1.5% of agarose gel electrophoresis, gel electrophoresis, imaging system observation imaging.

    1.3.4 spleen T lymphocyte proliferation was measured take 96-well plates added 1 × 106 spleen cell suspension, adding of ConA final concentration of 5μg/ml, at 37 ° C, 5% CO2 incubator for 48h per hole by adding 5mg/ml MTT 10μl, cultured for 4h per well DMSO was added to 100 μl of absorbance (OD) was read in a microplate reader at 570nm.

    1.3.5 spleen T Lymphocytes determination to take 96-well culture plates added to each well of 5 × 104 P815 cells placed in 37 ° C, 5% CO 2 incubator overnight. Control groups were sacrificed the next day, the tumor group, CTX alone in the treatment group and the combination treated mice, the spleen cells in IMDM containing 10% fetal calf serum culture medium to adjust the cell concentration, the effector to target cell ratios of 20:1, 100μl / well × 3 hole added to the above containing the target cells in 96-well culture plates. Using quantitative assay of lactate dehydrogenase (LDH) CTLs.

    1.3.6 statistical methods used for SPSS10.0 statistical package processing data. The experimental results to ± s groups were compared using the t-test, P <0.05 was considered statistically significant.

    2 Results

    2.1 dynamic changes in tumor volume and growth curve

    Since the first 7 days of the inoculation of tumor cells, tumor volume was measured, detected once every 3 days. The change in tumor volume over time logarithmic growth, as shown in Figure 1. The results showed that the combination therapy group compared with CTX alone treatment group significantly delayed tumor growth.

    2.2 CTX joint BCG mouse spleen CD4 + CD25 + of Treg cells quantitative impact

    The results showed that the tumor group spleen CD4 + CD25 + Treg cell number was significantly higher (P <0.05), the combination therapy group CD4 + CD25 + Treg cell number is lower than the tumor group (P <0.05); combination therapy CD4 + CD25 + of Treg cell number significantly lower than the tumor group, but slightly higher than the CTX group, as shown in Figure 2. May BCG activated CD4 + T cells, so that CD25 upregulation, therefore CD4 + CD25 + Treg immunosuppressive effects of the tumor may be reduced, while that might enhance the function of effector cells.

    The expression of Foxp3 mRNA 2.3 CTX combined BCG spleen of a control group of Foxp3 mRNA expression in mouse spleen (0.525 ± 0.199), tumor group expression of Foxp3 mRNA (1.375 ± 1.187) the CTX group Foxp3 mRNA expression levels (0.947 ± 0.373), Foxp3 mRNA expression levels of the combined treatment group (0.394 ± 0.197). The electrophoresis result is shown in Figure 3. Tumor mice spleen Foxp3 mRNA expression was significantly increased, the expression levels of the combined treatment group was significantly lower than the tumor group (P <0.05), but the the CTX group expression level is still higher than the normal control group. Indicating that tumorigenesis Foxp3 expression was significantly higher, and CTX combined with BCG treatment can reduce the expression. Groups SI (1.184 ± 0.261), CTX alone in the treatment group (1.412 ± 0.119) SI SI of the combined treatment group (1.747 ± 0.108). Mouse T lymphocyte function combined treatment group was significantly higher than the tumor group (P <0.05), slightly higher than the the CTX alone treatment group. The results showed that CTX with BCG treatment can improve the splenic T lymphocyte functions, making it possible to increase the anti-tumor immune.

    2.5 CTX joint BCG splenic T lymphocyte killing function

    Control group spleen T lymphocyte killing rate was 0.338 ± 0.093, the tumor group killing rate was 0.218 ± 0.051, the CTX alone treatment group killing rate was 0.289 ± 0.055, the killing rate of the combined treatment group 0.285 ± 0.049. 0.05)。">The results showed that the CTX combined with BCG treated mice spleen T lymphocyte cytotoxic activity is slightly higher than the tumor group, but the change was not significant (P> 0.05).

    3 Discussion

    Since 1995, Sakaguchi et al first proposed the CD4 + CD25 + regulatory T cells, causing more and more attention in the immune academia has its extensive research [1,5]. CD4 + CD25 + Treg cells are naturally occurring and mature in the thymus unique cell populations. Their study found that in vivo biological effects, has immunoregulatory function of CD4 + CD25 + Treg cells, are also involved in the inhibition of tumor immune response [6] while maintaining self-tolerance and immune. Therefore, the CD4 + CD25 + Treg cells not only in tumor escape, play a role in promoting the growth of tumors, tumor vaccines and immunostimulants to be ineffective.

    Cyclophosphamide are widely used in the treatment of many types of cancer [7  8]; same time, it can be used for the treatment of autoimmune diseases such as. Low-dose CTX possibly by enough to clear the CD4 + CD25 + Treg cells and restore anti-tumor activity in vivo effector T cells, thereby enhancing the anti-tumor immunity [9  10]. Our study found that the combination therapy compared with CTX treatment more significantly to improve peripheral lymphocyte proliferation function, suggesting that the combination therapy to stimulate the activation of effector cells, can reduce the CD4 + CD25 + Treg cells, inhibition of tumor effector cells, the immune system effectively on tumor cell destruction.

    New therapeutic strategies to inhibit or stimulate tumor immune response to clear the CD4 + CD25 + Treg cells, more effective tumor immunotherapy kind.
