Abstract Objective To detect MDR1 expression in ovarian cancer and to investigate its role in chemotherapy resistance in ovarian cancer. Methods RT  PCR the composite quantitative techniques of 40 patients with ovarian cancer, 20 patients with benign ovarian tumors, MDR1 expression in 20 cases of normal ovarian tissue to detect, analyze its expression with clinicopathological characteristics and chemotherapy correlation. MDR1 expression in ovarian cancer was significantly higher than the normal group and benign group, and the worse the degree of tumor differentiation the expression of the higher (P <0.05). MDR1 positive expression rate of preoperative chemotherapy group was significantly higher than the preoperative chemotherapy group (P <0.05). MDR1-negative patients, chemotherapy response rate was significantly higher than that of patients with positive group (70.6% vs. 43.5%), P <0.05, MDR1 negative effective chemotherapy predictive value of 70.6%. Conclusion MDR1 formation of acquired resistance in ovarian cancer may play a role of MDR1 detection of ovarian cancer chemotherapy may help to develop, and become a useful indicator to predict the efficacy of chemotherapy.

Key words ovarian cancer; multidrug resistance gene; reverse transcription  polymerase chain reaction

Expression of Multidrug Resistance Gene in Epithelial Ovarian Carcinoma and Its Clinical Significance

    LIANG Chuan, WU Xu  feng, CHEN Hui  jun

    Gynecologic Oncology Department of Zhongnan Hospital, Wuhan University, Wuhan 430071, China

    Corresponding Author: Wu Xu  feng, E  mail: wuxufeng@371.netAbstract: Objective To detect the expression of multidrug resistance gene (MDR1) in the epithelial ovarian carcinoma, and investigate its role in drug resistance. Methods The expression of MDR1 in 40 cases of ovarian carcinoma, 20 cases of benign ovarian tumor and 20 cases of normal control were determined by RT  PCR technique. The relations between MDR1 expression and the clinical  pathological characteristics as well as chemotherapeutic response were discussed. Results The positive expression rate of MDR1 in ovarian carcinoma was significantly higher than that in benign tumors and normal tissues, and a significant relationship was shown between its expression and pathologic differentiation, P <0.05. The MDR1 positive expression rate in cases received chemotherapy before surgery were significantly higher than in cases who didn’t, P <0.05. The response rate in the MDR1 negative group was higher than that in the positive group (70.6% vs 43.5%), P <0.05. The predictive value of negative MDR1 staining for objective response was 70.6 %. Conclusion These data suggested that MDR1 may play an important role in the acquired multidrug resistance of ovarian carcinoma. Determination of MDR1 expression may be useful for working out chemotherapy plan and predicting chemotherapeutic response of ovarian carcinoma patients.

    Key words: Ovarian carcinoma; Multidrug  resistance gene; Reverse transcription polymerase chain reaction

Although ovarian cancer is relatively sensitive to chemotherapy, but its long-term effect is not ideal, it was reported ovarian cancer chemotherapy for the first time up to 76% efficiency, but relapse later reduced to 20% [1], drug tolerance is important failure of chemotherapy reasons. Tumor resistance generated multiple genes involved in the complex process in which the multidrug resistance gene MDR1 (multidrug resistance gene  1) the encoded product P  glycoprotein (P  glycoproein, P  gp) efflux pump is the most widely used drug recognition [2], but its role in ovarian cancer is inconclusive. In this study, using reverse transcription  polymerase chain reaction (RT  PCR) the composite quantitative techniques, detection of ovarian cancer tissue MDR1mRNA expression and clinical data analysis, to explore its role in ovarian cancer.

    1 Materials and methods

    1.1 The object of study

    The Gynecologic Oncology Zhongnan Hospital of Wuhan University admitted on January 30, 1999 to December 30, 2006, in patients with ovarian cancer, 40 cases of the experimental group, take fresh tissue, -70 ℃. Early underwent the comprehensive staging exploratory surgery; advanced underwent cytoreductive surgery. Histologically confirmed 21 cases of serous adenocarcinoma, mucinous adenocarcinoma, endometrial cancer, 7 cases of clear cell carcinoma in 3 cases, 3 cases of undifferentiated carcinoma. Preoperative chemotherapy in 12 cases. Postoperative herein are platinum-based chemotherapy for six to eight courses, with the classic PC program, specifically: DDP 40 ~~ 60mg d1 ~~ d3; CTX 400 ~~ 600mg d1 ~~ d3, adjust the dose based on the patient’s body surface area. 20 cases of normal ovarian surgical resection in patients with benign gynecological diseases for the normal control group, 20 patients with benign ovarian tumor patient specimens as a healthy control group.

    1.2 reagent and experiment method

    1.2.1 RNA extraction Trizol (purchased from Intitrogen company) one-step extraction of total cellular RNA, UV spectrophotometric detection of all samples the A260/280 are greater than 1.70 formaldehyde agarose the denaturing electrophoresis Identification RNA extraction quality.

    1.2.2 cDNA first strand synthesis reverse transcription kit purchased from Toyobo reagents, all 1μg total RNA samples were taken, are then added to 5 × reverse transcriptase buffer 4μl, the reverse transcriptase 1μl, 10pmol/μl the Olig (dT ), 20 1μl, 10mmol / L dNTP 2μl, RnaseOUT 1μl, DEPC water complement to 20μl, 42 ° C for reaction 60min, 95 ° C inactivated reverse transcriptase enzyme 5min, product was stored at -20 ℃ mix well.

    1.2.3 PCR amplification the MDR1 upstream primer 5 ‘ ACTGAGCCTGGAGGTGAAGA  3’ downstream primer 5 ‘of  CCACCAGAGAGCTGAGTTCC  3’, amplified fragment length of 390 bp. An internal control β  actin upstream primer 5 ‘ CTACAA TGAGCTGCGTGTGGC  3’, downstream primer 5 ‘ CAGGTCCAGACGCAGGATGGC  3’, amplified fragment length of 260 bp. All samples were taken 100μg RNA reverse the resulting cDNA was amplified total reaction volume of 25 μl containing 10 × PCR Buffer 5μl, 10mmol / L dNTP 1μl, high-pressure pure water 13.2μl, upstream primer, 1.5μl of each primer, Taq DNA polymerase 2U. Denaturation at 94 ℃ for 30 s, 55 ° C annealing 30s, 72 ° C extends 30s, a total of 30 cycles, 72 ℃ for 10min. Agarose gel electrophoresis of PCR products, computer gel imaging system camera, ID software analysis stripe optical density value, calculate the ratio of MDR1 and β  actin as the parameters of the expression level of the line of semi-quantitative analysis.

    1.3 chemotherapy Rating

    6 to 8 cycles of chemotherapy, patients completed through a pelvic examination, B ultrasonic imaging examination, CA125 detection or secondary exploratory surgery findings to assess the efficacy of chemotherapy. Standard: (1) the chemosensitivity of ovarian cancer: initial complete remission was clinically proven, stopping for more than 6 months without recurrence; (2) resistant ovarian cancer: early reached clinical complete remission, but less than 6 months recurrence (CA125 increased physical examination a lump is found, pleural effusion, unexplained intestinal obstruction); (3) persistent ovarian cancer: early response to chemotherapy, but further examination of residual lesions; (4) refractory ovarian cancer: chemotherapy invalid, including tumor stability or progress during chemotherapy. We will (1) the definition of effective chemotherapy, and (2), (3), (4) is defined as the chemotherapy invalid [3].

    1.4 statistical methods

    Line statistical analysis using SPSS 14.0 package. Count Chi  square test was used to compare the data. P <0.05 was considered statistically significant.

    2 Results

    2.1 MDR1 expression in normal ovarian epithelium and benign and malignant ovarian tumors

    MDR1 amplified fragment length of 390 bp,, β  actin amplified fragment length 260bp, as shown in Figure 1. MDR1 expression in normal ovarian tissues, the positive expression of MDR1 in benign ovarian tumors was 10.0%, the positive expression in ovarian cancer tissue was 57.5%. The positive expression rate of MDR1 gene in ovarian cancer was significantly higher than that in the control group (P <0.01). Quantitative analysis of ovarian cancer MDR1 gene expression levels of 0.6685 ± 0.3447, significantly higher than benign ovarian tumors 0.0047 ± 0.0019, the difference was statistically significant (P <0.01).

    1,3,5, respectively, for the MDR1 ovarian cancer, benign ovarian tumors and normal

    2.2 MDR1 expression and clinicopathological features

    As shown in Table 1 of MDR1 expression and tumor differentiation into the degree of differentiation express the worse the higher (P <0.01); while with the patient’s age, tumor type, clinical stage were unrelated (P> 0.05).

    2.3 MDR1 expression and preoperative chemotherapy

    As shown in Table 2, the preoperative chemotherapy group MDR1 positive expression rate was 83.3%, significantly higher than the preoperative chemotherapy group (P <0.05).

    2.4 MDR1 expression and the relationship of the effects of chemotherapy

    Chemosensitivity of ovarian cancer in the experimental group, 16 cases; eight cases of drug-resistant ovarian cancer; 18 cases of persistent ovarian cancer; 8 cases of refractory ovarian cancer, chemotherapy, the overall response rate was 60.00%. As shown in Table 3, the MDR1-negative group of patients with chemotherapy response rate was significantly higher than that of patients with positive group (70.6% vs 43.5%) (P <0.05). MDR1-negative effective chemotherapy relationship Table 1 ovarian cancer MDR1 expression with clinicopathological features predictive value of 70.6%; of MDR1 positive predictive value of 56.5% on the drug. 23 cases the MDR1 positive for patients, according to the expression of strength further grouped (gene expression levels of 0.3238 to 0.6685 weakly positive; 0.6685 to 1.0132 as strongly positive), chemotherapy response in 10 patients, eight cases of weak expression, only 2 cases of strong positive expression.

    3 Discussion

    Multidrug resistance (multidrug resistance, MDR) refers to the emergence of drug-resistant tumor cells to an anticancer drug at the same time, the phenomenon of cross-resistance to other drugs on the structure and function of different. Domestic and international studies have shown that overexpression of the multidrug resistance gene (MDR1) is one of the important reasons that lead to multidrug resistance. MDR1 located at chromosome 7q21.1 with P  gp, encoded product for an energy-dependent drug Drain pump, combined with anticancer drugs after drug pump out to reduce the concentration of intracellular drug and lead to drug resistance, mainly with natural source of fat-soluble drug resistant, is known as the classic multidrug resistance [4].

    MDR1 expression levels in different tumor. Nooter et al [5] tumors were divided into three groups that MDR1 high expression of the tumor, such as cancer, response to chemotherapy is very low, is a natural resistance; of MDR1 moderate expression of tumor response to chemotherapy group compared with the previous good, but easy recurrence and recurrence resistance to chemotherapy; does not express or low expression of MDR1 tumor, chemotherapy may be effective. The MDR1 in ovarian cancer resistant inconclusive low, most of the reported MDR1 expression in ovarian cancer [6  7]. According to the classification of the Nooter principle is applied in the third group, that is not ovarian cancer MDR1 primary drug key factors [5]. However, the study found that the positive expression of MDR1 after chemotherapy or relapsed patients was significantly higher. Hille [8] showed that ovarian cancer tissue before chemotherapy low expression levels of P  gp, but long-term chemotherapy causes increased expression of the cause of acquired resistance. Ozalp [9] Studies have also shown similar results. In vitro studies also showed that the anti-cancer drugs can induce MDR1 expression in ovarian cancer cell lines [10]. The data show that in normal ovarian positive expression of MDR1, the ovary is not MDR1 enrichment organ. MDR1 expression in the preoperative chemotherapy group volume is still low, indicating that the MDR1 does not play a leading role in ovarian cancer primary resistance. Preoperative chemotherapy in patients with MDR1 expression was significantly higher chemotherapy might inspire induced the expression of MDR1, suggesting that the MDR1 acquired drug resistance may be associated with ovarian cancer, consistent with the results of relevant reports.

    This study shows that of MDR1 expression is low in benign ovarian tumors, but in ovarian cancer tissue was significantly higher (77.5%), and the worse the degree of tumor differentiation the expression of the higher, indicating that the tumor cells of malignant transformation process may induce activation of MDR1 the higher the expression, whether the degree of malignancy by MDR1 mediated drug efflux pump the stronger the effect, to be confirmed by further studies.

    Natural sources and fat-soluble drugs, such as doxorubicin combination chemotherapy in ovarian cancer are more commonly used drugs, especially Taxol extracted from plants, have become the first-line chemotherapy medication. Therefore, the detection of MDR1 expression may contribute to ovarian cancer patients, especially formulated to provide the basis of the recurrence chemotherapy. However, the relationship between MDR1 and ovarian cancer in the current study efficacy of chemotherapy is still controversial. Baekelandt, etc. [11] found that ovarian cancer P  gp of expression and chemotherapy efficacy significantly with relevant, patient’s independent prognostic factors; but also have studies show opposite results [12], the literature reported the results of the difference may be with the detection means different relevant. In this study, using RT  PCR technology to directly detect the expression of MDR1 and semi-quantitative analysis of a large extent, to avoid the experimental error Immunohistochemical detection of protein expression, results showed that MDR1 expression was significantly associated with the efficacy of chemotherapy, MDR1 negative The efficacy of chemotherapy, the expression of its negative predictive value as high as 70.6% effective chemotherapy, to think the MDR1 there may become a useful indicator to predict the efficacy of chemotherapy in ovarian cancer.

    This study despite the MDR1 positive patients are still 43.5% shown to be effective, but further subgroup analysis, we found that chemotherapy response in 10 patients, eight cases weakly positive expression, only two cases of strong positive expression. Therefore, we speculate that there may MDR1 expression level reaches a certain strength in order to give full play to the role of drug-draining pump, but more accurate quantitative detection methods need to be further validated.

    Tumor resistance generated multiple genes are involved, the result of the combined effects of the multi-step [13], the detection of a single indicator can not rule out other factors, of limited value for the prediction of the efficacy of chemotherapy, only through a multi-gene joint detection, can be more objective and comprehensive the screening efficiency and low toxicity drugs for different mechanisms of resistance, in order to guide the formulation of the individual chemotherapy.