Abstract Objective To investigate the IFN  γ gene +874 single nucleotide polymorphisms and breast cancer correlation. Methods PCR technique on 94 patients with breast cancer and 96 cases of normal women IFN  γ gene +874 A / T single nucleotide polymorphism (SNP) analysis of the PCR products were cloned and sequenced. Results of breast cancer patients with IFN  γ gene +874 TT genotype frequency was 18.1%, significantly higher than the normal 8.3%, compared with between significant difference (χ 2 = 3.95, P = 0.047); breast cancer case group T allele frequency was significantly higher than that of the control group (χ2 = 4.984, P = 0.026). Further analysis showed that, compared to the genotype and allele frequencies of different ages in the group of breast cancer cases, there was no significant difference. Conclusion IFN  γ gene +874 TT genotype may be associated with the incidence of breast cancer, the T allele may be a genetic risk factors for breast cancer.

Key words breast cancer; interferon  γ; single nucleotide; polymorphism; genotype

Association of Single Nucleotide Polymorphism of Interferon  gamma Gene +874 Site and Breast Cancer

    WU Guang  heng, ZHANG Jia  ying, LU Pei  xin

    School of Norman Bethune Medical Sciences of Jilin University, Changchun 130021, China

    Corresponding Author: ZHANG Jia  ying, E  mail: jiaying@jlu.edu.cnAbstract: Objective To explore the relationship between the single nucleotide polymorphism of interferon  gamma gene +874 site and breast cancer. Methods Using PCR technique to analyze the single nucleotide polymorphism (SNP) of Interferon  gamma Gene +874 site A / T of 96 normal women and 94 female breast cancer patients, the PCR products were cloned and sequenced. Results The frequency of interferon  gamma gene +874 site TT genotype was significantly higher in patients with breast cancer than that in the healthy individuals (18.1% vs 8.3%, P <0.05); T allele frequency was higher in breast cancer group than in normal group. But the TT genotype had no significant correlation with the age in breast cancer patients. Conclusion TT genotype of IFN  γ +874 site might have a relationship with generation of breast cancer.

    Key words: Breast cancer; IFN  γ; Single nucleotide; Polymorphism; Genotype

Interferon is a multifunctional cytokine, and has a certain effect on the treatment of many diseases, including tumors, including. The study showed that [1], IFN  γ gene was six polymorphic loci. The first intron of the IFN  γ gene +874 A / T single nucleotide polymorphism (SNP) transcription factor binding sites can change, affecting its expression [2]. Currently, the locus polymorphisms with certain types of disease-related have been reported, but breast cancer has not been reported whether the relevant domestic. Single nucleotide polymorphism distribution analysis of to extract peripheral blood DNA using specific primers for PCR amplification explore IFN  γ gene +874 correlation with breast cancer.

    1 Materials and Methods

    1.1 Data

    The experiment was divided into case and control groups. The case group: pathological diagnosis of breast cancer and the exclusion of the 94 cases of the other blood samples of cancer patients, hospitalized patients from the Tumor Hospital of Jilin Province; control group: 96 cases of normal physical examination female blood samples. The case and control groups between the ages of 30 to 67-year-old.

    1.2 Methods

    The genomic DNA was extracted using phenol extraction method imitation. IFN  γ sequence (NC  000012), primers were designed using primer 5.0, the product of length 527bp. Forward primer 1:5 ‘ cgcgcaacacaaaatcaaatca  3’, the forward primer 2:5 ‘of  cgcgcaacacaaaatcaaatct  3’, reverse universal primer: 5 ‘ gctacatctgaatgacctgc  3’. Human GAPDH internal reference control the forward primer: 5 ‘ tattgggcgcctggtcac  CA  3’, reverse primer: 5 ‘ ccaccttcttgatgtcatca  3’, the product is long

    : 746bp, for the identification of PCR system. Primers synthesized by Parkson race. PCR conditions: 94 ° C denaturation 2min, 94 ° C denaturation 50s, 56 ° C annealing 50s, extension at 72 ° C for 1 min, 30 cycles at 72 ℃ 10min. PCR products were separated on a 1% agarose gel electrophoresis, the gel image analysis. AA, TT genotype fragment recovery, purification, sequencing analysis; to TT genotype ligated to pGEM  T carrier, the recombinant plasmid sequencing.

    1.3 statistical methods

    The genotype and allele frequency distribution of differences in each group using χ2 test.

    2 Results

    After electrophoresis of PCR products, in accordance with the single nucleotide polymorphism (SNP) is divided into three different genotypes AA, AT and TT, etc., shown in Figure 1, the same sample using a forward primer 1,2 and reverse universal primer twice the amplified 527bp fragment of the AT genotype; appear only once as AA or TT genotype 527bp amplification product. All samples were amplified 746bp internal reference control. The case and control groups are in line with the Hardy  Wein  berg genetic equilibrium. TT genotype frequency difference between the case and control groups was statistically significant (χ2 = 3.95, P = 0.047, OR = 2.429,95% CI: 1.013 ~ 5.827); case group T allele frequency was significantly higher than The control group (χ 2 = 4.984, P = 0.026, OR = 1.640,95% CI: 1.062 to 2.532). The case group compared to the genotype and allele frequencies of different age difference was not statistically significant (P> 0.05), as shown in Table 1. IFN  γ gene +874 AA genotype and TT genotype sequencing results shown in Figure 3. Table 1 breast cancer case group and the control group between the genotype and allele frequency distribution

    3 Discussion

    IFN  γ, with a wide range of anti-viral, anti-tumor and immunomodulatory cytokines as a host body, is an important part in the body’s defense system. The study showed that [3] IFN  γ gene intron 1 CA repeat sequences, including the CA repeat 12 times the individual peripheral blood nuclear cells IFN  γ expression highest.

    +874 Happens in the binding sites of the transcription factor NF  kappaB here the SNP directly affect transcription factor binding capacity, thus affecting mRNA transcription of IFN  γ [4].

    Experimental results show that the breast cancer patients in the IFN  γ +874 points TT genotype frequency was significantly higher than normal, suggesting that the TT genotype may be breast cancer susceptibility genotype has a role in the incidence of breast cancer, IFN  γ +874 SNP may be involved in the pathogenesis of breast cancer by affecting the secretion of IFN  γ. The T allele frequency of breast cancer cases group was significantly higher than that of the control group, may presage the T allele genetic risk factors for breast cancer. In addition, the group of breast cancer cases, compared to the genotype and allele frequencies of different ages, there was no significant difference between the possible and the number of cases is not large enough, and the decomposition of a smaller number of cases related to all ages.

    Kamali  Sarvestani [5] in the crowd of Iranian women found that breast cancer patients in the IFN  γ gene +874 TT genotype frequency was significantly higher than the normal population, which is cross-checked with the results of the experiment, but the TT genotype constituent ratio was much higher than the experimental data, which may be associated with racial differences. Academic studies show that [6], colorectal cancer patients in the IFN  γ +874 AA genotype frequency was significantly higher than normal. Breast cancer is caused by genetic, immune, and environmental factors such as common role, this study provides a new reference to the etiology of breast cancer research, provide research data for clinical treatment and prevention.