Abstract Objective To investigate the impact of different genotypes of p53 Arg72Pro p53 protein and its function protein expression in HPV16 E6, for the study of cervical cancer carcinogenic mechanism to provide a theoretical basis for. Liposomes eukaryotic expression () A by carrier pcDNA3.1/myc-His  HPV16 E6 the transfection p53Arg and p53Pro cells by immunocytochemistry after transfection both intracellular p53, p21, Bax , Ki  67 protein detection. Results of the transfected two cell p53, Bax, Ki  67 protein expression affected, but little change in p21 protein. Conclusion of two intracellular p53 protein can be degraded both inhibit cell proliferation and induce apoptosis reduced ability is degraded to varying degrees, by different mechanisms lead to cervical cancer.

Key words p53 gene; polymorphism; HPV; cell cycle; apoptosis

  Correlation between HPV16 E6 and p53Arg72Pro Polymorphisms

    LI Xin  min *, PAN Xiao  lin, YANG An  qiang, ZHENG Xing  zheng, ZHOU Qiu  yuan

    Ministry of Education Key Laboratory of Xinjiang Endemic and Ethnic Disease / Department of Pathology, Shihezi University, Shihezi 832002, China (* Present: The Maternal and Child Health Care Hospital of Zhengzhou, Zhengzhou 450053)

    Corresponding Author: PAN Xiao  lin, E  mail: pxl1025@Yahoo.com.cnAbstract: Objective To discuss correlation between HPV16 E6 and p53Arg72Pro polymorphisms, it provided academic evidence for the mechanism of cervical cancer.Methods pcDNA 3.1/myc  His ( ) A  HPV16 E6 was transfected into p53 codon 72 genotype cell lines, Arg homozygous (SK  BR  3) and Pro homozygous (MIA PaCa  2). Immunocytochemistry was used to detected the expression of protein of p53, p21, Bax , Ki67 proteins in these cells which were transfected by HPV16 E6.Results After being transfected, the expression of p53, Bax, Ki  67 were effected in those cells, expect for p21 protein.Conclusion After the eukaryotic expression vector pcDNA3.1/myc  His () A  HPV16 E6 was transfected into the Arg homozygous and Pro homozygous cells, the p53Arg and p53Pro proteins were all degraded by HPV16 E6. And the ability of proliferation and apoptosis of the cells were depressed to a different degree.

    Key words: p53 gene; Polymorphism; HPV; Cell cycle; Apoptosis

 The p53 gene is the most important tumor suppressor genes in the body, through the transcriptional activation of the downstream gene p21, p16, Gadd45 and bax to play in the regulation of the cell cycle, DNA repair, apoptosis suppressor effect. The present study shows that the loss of p53 function related to the occurrence of about 70% of human tumors, human papillomavirus (Human papillomavirus, HPV) infection leads to functional inactivation of p53 protein is the major causative factor for cervical cancer. Domestic and international studies have shown that high-risk types of HPV can be detected in approximately 99.7% of cervical squamous cell carcinoma and 70% of cervical adenocarcinoma [1]. Including HPV16 and 18 with cervical cancer occur most relevant encoding E6 protein loss of a living organism p53 protein in cervical cancer HPV-associated tumors based carcinogenic mechanism.

    In recent years, studies show that 4 of the p53 gene exon 72 codon (p53 Arg72Pro) the encoded two the protein p53Arg and p53Pro function inactivation closely related with the development of cervical cancer, but cervical cancer mechanism unclear, so this paper put forward the hypothesis: p53Arg, and p53Pro proteins by the HPV16 E6 protein degradation inactivation, the two may be through increased cell proliferation activity based mechanisms or to induce apoptosis ability to reduce the main mechanism lead to cervical cancer place.

    1 Materials and methods

    1.1 Materials cell lines, the carrier p53Arg homozygous (SK  BR  3) cells were purchased from Cell Center of China Peking Union Medical College; p53Pro homozygous (MIA Paca  2) cells were purchased from ATCC. Lawrence Banks, professor kindly in plasmid pSP64  HPV16 E6 Italy international genetic and biological engineering center.

    1.2 cell culture p53Arg, and p53Pro cells  s 5A culture medium and DMEM medium containing 10% fetal calf serum McCoy, 37 ° C, 5% CO2, constant humidity culture.

    1.3 HPV16 E6 gene eukaryotic recombinant plasmid and cells transfected with HPV16 E6 gene was cloned into the eukaryotic expression vector pcDNA3.1/myc  the His () A (Invitrogen), recombinant plasmid pcDNA3.1/myc  His () A  HPV16 E6. Transfected using Lipofectamine 2000 (invitrogen company) for the experimental analysis of 48 for 72 hours.

    The 1.4 total cellular RNA was extracted after transfection the cultivation of p53Arg, and p53Pro cells were extracted using Trizol kit (BBI) Total RNA (instructions). RNA concentration was measured, 1% Agarose identification purity.

    1.5 reverse transcription  polymerase chain reaction (RT  PCR) RT-PCR primers were designed according to the HPV16 E6 mRNA sequence (GenBank Accession AF486313) upstream primer: 5 ‘ CGCGGATCCATGCACCAAAAGAGAACTGCAATGTT  3’, downstream primer: 5 ‘ CATGCAAGCTTCAGCTGGGTTTCT  3’ ; an internal reference β  actin upstream primer: 5 ‘ CATGTTTGAGACCTTCAACACC  3’ downstream primer: 5 ‘ TTGCCAATGGTGATGACCTG  3’. 55 ℃ 30min reverse transcriptase the 94 ℃ RTase lost live 2min 30s at 92 ° C and 54 ° C 30s, 30 cycles of 72 ° C 1.5min conditions, 72 ℃ 6min extension. The amplification products 5μl HPV16 E6 and β  actin electrophoresis with absorbance integral relative value of the ratio as of HPV16 E6mRNA level of 2% Agarose gel electrophoresis, DH2000 analysis software.

    The of 1.6 Experimental groups p53Arg and the p53Pro cells divided into 3 groups: ① not transfected group (not dyed any carrier); 2 transfection (the transfection pcDNA3.1/myc  His () A  HPV16 E6) E6 group; ③ The turn transfected with empty vector group (transfected pcDNA3.1/myc  His () A).

    1.7 immunocytochemistry using Envision law, p53 antibody (1:150) of p21 antibody (1:100), Ki  67 antibody (1:75), of Bax antibody (1:200), both of Fuzhou step biotechnology development of Limited monoclonal antibody. Breast cancer test kit positive samples as positive control, as control antibody was replaced with PBS.

    1.8 Analysis of untransfected and transfected E6 group two cells were selected five films, transfected with empty vector group selected four films, each the film randomly selected five horizons, p53, p21, Bax indicators Image  the average gray value of the the pro 5.1 Chinese software testing positive products, OD values; Ki  67 indicates the percentage of positive cells (%).

    1.9 Statistical Methods SPSS13.0 statistical software, Ki  67 H test; of p53, p21 and Bax compared by one-way ANOVA.

    2 Results

    2.1 after transfection Identification of intracellular mRNA 2% Agarose electrophoresis identified within the reference bands of β  actin 680bp at 497bp at two lanes in specific bands amplified, indicating that the two cell lines containing HPV16 The E6 gene transfection success, as shown in Figure 1, 2.

    2.2 transfected cells in immunocytochemistry results

    2.2.1 p53 protein expression of p53 protein in both cell located in the nucleus, was tan / brown granular positive. In both cells transfected with empty vector group compared with untransfected group, p53 protein expression differences were not statistically significant; transfected E6 group compared with untransfected p53 protein expression intensity decreased as shown in Table 1. Compare decreased: p53Arg protein reduce the more obvious, as shown in Figure 3.

    2.2.2 p21 protein expression of p21 protein in both cell located in the nucleus, pale yellow granular positive. The results show the before and after transfection, both intracellular almost no positive cells.

    2.2.3 Ki  67 protein expression in both cell Ki  67 protein is localized in the nucleus, was tan / brown granular positive. In both cells, transfected with empty vector group compared with untransfected group, Ki  67 protein expression differences were not statistically significant; transfected the E6 group with not table the two cell transfected p53 protein before and after the HPV16 E6 expression (*: P = 0.000 (P <0.05); #: P = 0.001 (P <0.05) compared compared with no transfection transfection group, Ki  67 protein expression intensity increased as shown in Table 2. comparison transfected after increasing tendency p53Pro intracellular protein Ki  67 increased more obvious, see Figure 4 Table 2 two types of cells transfected with HPV16 E6 Ki  67 protein expression before and after the positive rate *: χ2 = 3.938, P = 0.047 (P < 0.05); #: χ2 = 5.771, P = 0.016 (P <0.05) compared with no transfection2.2.4 Bax protein expression in both cell Bax protein was localized in the cytoplasm, pale yellow granular positive. p53Arg cells , Bax protein expression compared to three groups showed no significant difference in p53Pro cells transfected with empty vector group and untransfected group compared Bax protein expression was no significant difference; transfection the E6 group with not turn transfected group compared Bax protein expression strength decreased, as shown in Table 3. relatively decreased after transfection found p53Pro intracellular Bax protein decreased slightly obvious, as shown in Figure 5 Table 3 two kinds of cells transfected with Bax protein expression before and after the HPV16 E6

    3 Discussion

    High-risk HPV16 is closely related to the occurrence of cervical cancer, the p53 protein encoded E6 protein degradation, loss of p53 in cell cycle regulation, induced apoptosis and DNA repair function is the main mechanism of cervical cancer. In recent years, studies have shown that the function of the p53 Arg72Pro gene polymorphism the encoding of p53Arg and p53Pro protein in inactivation of tumors may be caused by different mechanisms: p53Arg with a strong combination of high-risk HPV E6 protein, induction of apoptosis and inhibition of cell transformation the ability [2  3]; p53Pro strong transcriptional activation downstream of p21, Gadd45 therefore has strong cell cycle arrest and DNA repair function [4].

    This study shows that: the p53Arg, and p53Pro proteins can be HPV16 E6 Part degradation degree of but p53Arg reduced than p53Pro protein and 1998 Storey et al [5] and in 1999, Thomas et al [2] results are prompted p53Arg form p53/E6/E6  AP protein complexes or p53/E6/p300 of protein complexes combined with HPV16 E6 protein may be more degradation [5  7], Therefore, p53Arg inactivation can be enhanced HPV-associated cervical cancer easily emotional [5,8].

    lower down p21 transcriptional activation ability of p53 expression. HPV16 E6 before and after the study of p21 protein in both cell basically does not expression, suggesting that the expression of p21 protein in both cell from p53Pro and p53Arg transcription activation impact, with some reported in the literature [9  10] both intracellular almost no p21 protein expression results; Su et al [11], the results are inconsistent, they found p53 Pro more than p53Arg, the significant activation of p21 mRNA expression.

    After transfection, both intracellular Ki  67 proliferation index were increased, which is consistent with the findings of Thomas et al [2]. Under normal circumstances, the role of the p53 protein on the cell cycle arrest mainly through the G1 / S phase monitoring point adjustment, p53 start the transcription of p21 / p16 p21/p16 and cyclinE  CDK2/cyclinD  CDK4 / 6 complex combination of the two The complexes can inhibit CDK activation RB dephosphorylated to prevent E2F release of cell cycle arrest at the G1 / S, to provide sufficient time for DNA repair [12]. Basic p21 protein expression in the two types of cells found in this study, but Ki  67 proliferation index increased cell cycle arrest prompted the p53Arg, and p53Pro protein is degraded weakened, and the p53Pro protein degradation resistance of the cell cycle Lag weakened more obvious. Speculated that these two polymorphic protein negative regulator of cell proliferation by transcriptional activation of the p16 pathway. The HPV16 E6 degradation p53Arg, and p53Pro proteins, transcriptional activation of p16 ability to weaken, reduce cell cycle arrest, and cell cycle arrest p53Pro protein degradation reduce more obvious.

    the p53Arg and p53Pro protein HPV16 E6 role in transcriptional activation of bax results show the ability to significantly reduce p53Pro transcriptional activation of bax, suggesting that the ability of p53Pro induced apoptosis. This is consistent with the findings of some scholars, they believe that the five PXXP binding region p53Pro as SH3 binding motif one of the functions involved in the regulation of apoptosis [13], inducing apoptosis capacity should be stronger than p53Arg. 2006, Bergamaschi et al [14] study also found p53Pro transcriptional activity and the ability to induce apoptosis ASPP protein enhanced. But inconsistent with the findings of Dumont, Sullivan [3,15], they to think p53Arg more effectively than p53Pro induce apoptosis, it may be because: p53Arg effective transcriptional activation the AIP1 and PIGPC1 of genes more effectively induce apoptosis; and p53Arg and nuclear export protein CRM Ⅰ combined effectively positioning the mitochondria, and then promote apoptosis and mitochondrial GRP75 protein interactions. Visible of p53 Arg72Pro gene polymorphism encoding two proteins are degraded, both inhibit cell proliferation and induce apoptosis reduced ability of different levels, through different mechanisms lead to the occurrence of cervical cancer: p53Pro cell proliferative activity increased more obvious ; p53Pro cells induced the apoptotic ability to reduce the more obvious; these two proteins are activated transcription of the p21 gene had no significant effect.

    In summary, this paper the eukaryotic expression of carrier pcDNA3.1/myc  His () A  HPV16 E6 transfected p53Arg, and p53Pro cell, explore the HPV16 E6 protein of the p53 protein and its function of the the p53 Arg72Pro different genotypes expression in cervical cancer mechanism is important.