Abstract Objective To investigate the epoxy-the synthase  2 (COX  2)-specific small interfering RNA (siRNA) eukaryotic expression plasmid of HT  29 cells COX  2 expression and growth of human colon. Designed short hairpin structure of COX  2 siRNA corresponding template DNA sequence build by recombinant plasmid pshCOX-2. Human colon cancer HT  29 cells transfected with the recombinant plasmid by reverse transcription  polymerase chain reaction (RT  PCR) and Western blot, respectively, from the mRNA and protein levels detected COX  2 expression. Tetrazolium bromide (MTT) assay and flow cytometry COX  2 expression was inhibited cell growth was observed, radioimmunoassay (RIA) and ELISA were detected in the culture supernatant of PGE2 and VEGF content changes. Restriction analysis and sequencing results confirmed that the plasmid pshCOX  successfully constructed. Transfected with the recombinant plasmid 72h of HT  29 cells COX  2 mRNA and protein expression (P <0.05) significantly inhibited cell growth inhibition, a significant increase in the number of apoptotic cells (P <0.05), cell PGE2 and VEGF production by inhibition of (P <0.05). Conclusion We have successfully built COX  the 2 siRNA eukaryotic the expression plasmid pshCOX  2 through the inhibition of human colon cancer HT  29 cells COX  2 gene expression, thereby inhibiting cell growth, PGE2 synthesis and production of VEGF.

Key words cyclooxygenase  2; siRNA; RNA interference; eukaryotic expression plasmid; colon cancer

Effect of Eukaryotic Expression Plasmid for Cyclooxygenase  2 Specific siRNA on Growth of HT  29 Cells in vitro

    WANG Lei1, CHEN Wei  chang1, YANG Ji  cheng 2

    1. Department of Gastroenterology, The First Affiliated Hospital of Soochow University, Soochow 215006, China; 2. Department of Cellular and Molecular Biology, Soochow University

    Corresponding Author: CHEN Wei  chang, E  mail: weichangchen@126.comAbstract: Objective To investigate the effect of the eukaryotic expression plasmid of specific small interfering RNA (siRNA) against COX  2 gene on the COX  2 expression and growth of human colon cancer HT  29 cells. Methods The COX  2 siRNA template DNA sequence for short hairpin RNA (shRNA) was designed and synthesized. The recombinant plasmid (pshCOX  2) was transfected into HT  29 cells. The effect of the recombinant plasmid on the COX  2 expression of human colon cancer HT  29 cells was detected by RT  PCR and Western blot. Changes of the cell growth activity in response to transfected plasmid were evaluated by MTT assay and FCM. The methods of RIA and ELISA were respectively used to estimate the content of PGE2 and VEGF in supernatant. Results It was confirmed by restrictive enzyme digestion and sequence analysis that the recombinant plasmid was cloned and the aim sequence was obtained. The COX  2 expression of HT  29 cells was inhibited at mRNA and protein levels 72 hours after transfected with the recombinant pshCOX  2. The growth of HT  29 cells was inhibited and the apoptotic ratio was significantly highly in COX  2 siRNA transfected group than those in control groups (P <0.05). The content of PGE2 and VEGF in supernatant decreased significantly by transfecting pshCOX  2. Conclusion COX  2 siRNA expression plasmid pshCOX  2 successfully constructed can inhibit the expression of COX  2 gene, proliferation and synthesis of PGE2 and VEGF of HT  29 cells .

    Key words: Cyclooxygenase  2; siRNA; RNA interference; Eukaryotic expression plasmid; Colon cancer

RNA interference (RNA inference RNAi) has developed rapidly in recent years, a new study of gene function means, it is the use of small fragments of double-stranded RNA (dsRNA) homologous to the target gene, small interfering RNA (siRNA), transfected target cells, promote target gene mRNA degradation, thus specificity induced post-transcriptional gene silencing (the post  transcriptional gene silencing, PTGS) []. But chemically synthesized siRNA cost too much and the role in a short time, usually only a few cell cycle, can not fully meet the requirements of the long-term experimental study. 2002 by Brummelkamp, ​​etc. [2] first reported siRNA corresponding to the template double-stranded DNA sequence cloned into a plasmid transfected cells, DNA template into small fragments in the intracellular transcription hairpin RNA (shRNA), this shRNA and Chemistry synthetic siRNA has the same genetic closed role, but the role of time can be up to 2 months. So we build for colon cancer is highly expressed gene COX  2 siRNA expression plasmid transfected human colon cancer HT  29 cells were observed on HT  29 cell expression of COX  2 expression and the growth of colon cancer in order to investigate COX  2 gene function provide new means.

    1 Materials and methods

    1.1 Reagents

    Total RNA extraction reagent and RT  PCR reagents boxes purchased at Fermentas Company; transfer dye reagents lipofectamineTM2000 purchased from Invitrogen; COX  2 polyclonal antibody purchased at Cayman Chemical Company; expression of COX  2 primers and internal parameter β  actin primer material by the Shanghai Health Engineering The synthesized, COX-2 the of siRNA transcription template and plasmid pGPH1,,  GFP  Neo on Hai Jima. Human VEGF ELISA kit was purchased from Shanghai beautifully, PGE2 assay kit provided by the Suzhou University Institute of Hematology.

    1.2 expression of COX  2 siRNA sequence design

    SiRNA design principles [3  4], use of Ambion’s “siRNA Target Finder and Design Tools", according to the NCBI database COX  2 gene (Gene Bank ID NM000963) cDNA, designed for COX  2cDNA 1 689 ~ 1 DNA fragment of the nucleotide sequence of the 707 position was basic for researching NS gene by BLAST Search Search recognized COX  2 other than the known human gene sequence with no homology. Sequence is as follows: sense5 ‘ GGA CTT ATG GGT AAT GTT A  3’, anti  sense 5 ‘ TAA CAT TAC CCA TAA GTC C  3’.

    1.3 COX  2 siRNA expression plasmid and identification

    1.3.1 shRNA transcription template DNA, siRNA sequence design front design, the design of the total length of 58nt template DNA strand two synthesized by Shanghai GeneChem companies. Bbs Ⅰ restriction sites of its order of 19 nt sense sequence, 9 nt loop adapter sequence, 19 nt antisense sequence, RNA polymerase Ⅲ abort sub (six T), BamH I restriction sites. Sequence: Justice: The 5 ‘ CAC CGG ACT the TAT GGG TAA the TGT the TAT the TCA AGA GAT AAC ATT the ACC CAT AAG TCC TTT TTT G  3’, antisense: 3 ‘ CCT GAA the TAC the CCA TTA the CAA TAA GTT the CTC the TAT the TGT AAT GGG TAT TCA GGA AAA AAC CTA G  5 ‘.

    1.3.2 plasmid pshCOX  of the building pGPH1  GFP  Neo plasmid, human RNA polymerase III promoter H1 promoter, resistance marker for kanamycin and neomycin. Single-strand annealing first two templates. For electrophoresis, plastic recycling pGPH1  GFP  Neo plasmid Bbs Ⅰ and BamH Ⅰ digested linearized plasmid using T4 DNA ligase annealed shRNA template DNA was cloned after to pGPH1  GFP  Neo plasmid H1 promoter construct The recombinant plasmid. Converting a recombinant Escherichia coli DH5α, kanamycin-resistant clones, the amplified rocking bacteria, plasmids were extracted and purified named as pshCOX  2.

    1.3.3 Identification of recombinants by restriction endonuclease BBS I and BamH Ⅰ The plasmid pshCOX  2 double digested into two fragments, the molecular weight of the insert the promoter and the vector fragment by electrophoresis. The recombinant plasmid was sequenced by Shanghai Invitrogen Biotechnology Co., Ltd..

    1.4 Cell culture and transfection

    Human colon cancer cell line HT  29 purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences, the cells were seeded in containing 10% heat-inactivated fetal bovine serum, 1% glutamine and 1 × antibiotic mixed solution McCoy’s 5A (purchased in GiBco company) to the culture medium at 37 ℃ routinely cultured in 5% CO 2 incubator. 4 × 105 cells / well in 6-well plates HT  29 cells were incubated overnight in serum-free medium without antibiotics containing plasmid 5μg per hole 250μl serum-free medium formulated as a liquid mixture of 12.5μl LipofectamineTM 2000 and 250μl serum-free medium formulated as a liquid mixture of two kinds of mixture were incubated at room temperature for 5min after mixing, and then incubated at room temperature for 20min after adding serum-free and antibiotic cell culture fluid, 6h after replacing whole broth, 48h after transfection observed under a fluorescence microscope. The negative siRNA plasmid as a negative control group, PBS was used instead of the plasmid as a blank group.

    1.5 RT  PCR determination of COX  2 mRNA

    Transfection 24,48,72 h and cells in 6-well plates were collected in the weeks after RT  PCR amplification of cells, COX  2 mRNA expression of COX  2 upstream primer 5 ‘ the TTC AAA TGA GAT the TGT GGG AAA ATT GCT  3 ‘, downstream primer 5’  AGA TCA TCT CTG CCT GAG TAT CTT  3 ‘. The reaction conditions were 95 ° C denaturation 2min, 95 ° C denaturation 30s, 60 ℃ annealing 30s, 72 ℃ extension of the 30s, a total of 32 cycles, the final products was 72 ° C and then extend 5min. Β  actin as a loading control, the upstream primer 5 ‘ GAAACTACCTTCAACTCCATC  3’, downstream primer 5 ‘of  CGAGGCCAGGATGGAGCCGCC  3’. Amplified COX  2 product length 305bp, 219bp β  actin length. Taken amplification product 10μl, plus bromophenol blue 1μl, after electrophoretic separation in a 1.0% agarose gel containing ethidium bromide, the gel scanner electrophoretic band intensity analysis, using BioCaptMW software measured COX  2 / β  actin value as the expression level of the parameters.

    1.6 Western blot detection of COX  2 protein expression

    HT  29 collected from each group of 1 × 107 cells, total protein was extracted by 10% SDS  PAGE separation gel and a 5% SDS  PAGE concentrated gel sample, respectively, and a 90V constant voltage electrophoresis of approximately 2H, 60V constant voltage electrophoresis approximately 90min, then with 110V constant voltage 1.5h electrically transferred to a nitrocellulose membrane, then closed overnight. Polyclonal rabbit anti-human COX  2 protein antibody (1:1 000) plus hybrid 2h at room temperature, after washing the membrane, goat anti-rabbit secondary antibody IgG (1:2 000) antibody with shaking at room temperature for 1h. ECL color darkroom exposure to X-ray film to take pictures, record results.

    1.7 MTT assay of recombinant plasmid transfected HT  29 cell growth

    HT  29 cells in logarithmic growth phase to 1 × 104 / well were seeded in 96-well plates in conventional culture 24h after, plus transfection factors, each group of three wells, and a blank control group, negative control group, continue cultured for 1-7 days in each well were added 5g / L MTT 10μl, 37 ° C incubated for 4h, each well by adding 10% SDS  Cl 100μl, oscillate slightly purple blue precipitate was dissolved, and A570nm was measured with a microplate reader.

    1.8 flow cytometry recombinant plasmid apoptosis of HT  29

    4 × 105 / well were seeded in HT  29 cells in logarithmic growth phase were routinely cultured in 6-well plates for 24h, plus transfection factors, blank control group, negative control group. 72h charged cells, PBS wash after 2 or 3 times, 70% alcohol fixed, the change of flow cytometry to detect apoptosis.

    1.9 RIA method for the determination of PGE2 in cell supernatants

    4 × 105 / well were seeded in HT  29 cells in logarithmic growth phase were routinely cultured in 6-well plates for 24h, plus transfection factors, blank control group, negative control group. The cell culture supernatant was collected after 24, 48 and 72h, respectively, PGE2 content (pg / ml) were measured by radioimmunoassay.

    The 1.10 ELISA method for the determination of cell supernatant VEGF content

    4 × 105 / well were seeded in HT  29 cells in logarithmic growth phase were routinely cultured in 6-well plates for 24h, plus transfection factors, blank control group, negative control group. Culture supernatants collected after 24, 48 and 72h, respectively ELISA assay content of VEGF (pg / ml).

    1.11 Statistical Methods

    All data were statistically analyzed using SAS 8.0 statistical package, the data are ± s, P <0.05 for the difference was statistically significant.

    2 Results

    2.1 COX  2 siRNA eukaryotic expression plasmid identification

    pshCOX  2 after electrophoresis after digestion can be observed in a band about 5000bp and 100bp each line pGPH1  GFP  Neo plasmid (5075bp) and the fragment (58bp) inserted shRNA characterized, as shown in Figure 1. Sequencing confirmed that the design of the short hairpin structure COX  2 siRNA corresponding template DNA sequence is the same, that the recombinant plasmid containing the siRNA template DNA fragments can be transcribed.

    The 2.2 recombinant plasmid transfected cells observed

    The plasmid containing a gene encoding GFP, transfected cells under a fluorescence microscope to stimulate the green fluorescence, shown in Figure 2, the transfection efficiency can reach 80% or more, and confirmed that the recombinant plasmid in the cells of HT  29 have expressed.

    2.3 transfected with the recombinant plasmid expression of COX  2 mRNA

    0.05),转染重组质粒的HT29细胞与空白">Blank control group and negative plasmid transfection group 24,48,72 h after transfection, cells 1 week COX  2 mRNA expression was no significant difference (P> 0.05), transfected with the recombinant plasmid HT  29 cells blank compared to the control group in transfected for 24 and 48h COX  2 mRNA expression was unaffected, 72h and one week of HT  29 cells COX  2 mRNA expression level was significantly lower than that of the control and the negative control group, the difference was statistically significant (P <0.05), Table 1, Figure 3. The results showed that the recombinant eukaryotic expression plasmid transfection significantly inhibited of HT  29 cells COX  2mRNA expression.

    2.4 recombinant plasmid transfected cells expression of COX  2 protein expression

    Transfected with the recombinant plasmid 72h extract groups of HT  29 cells the proteins COX  2 protein expression using Western blot analysis, as shown in Figure 4, the results found COX  2 protein expression of recombinant plasmid transfected cells was significantly lower than the blank control and negative control group, the results are consistent with RT  PCR.

    A value of 2.5 MTT assay recombinant plasmid of HT  29 cells grown in Table 1 recombinant plasmid cell COX  2 mRNA expression detected by MTT assay of cells in each group, are shown in Table 2, Figure 5, transfected with the recombinant plasmid blank and negative controls, 24h, cell growth have not been significantly affected (F = 0.14, P = .8721), 48h after transfection suppressed cell growth (F = 17.68, P = 0.0031) after 72 hours inhibition more obvious (F = 43.14, P = 0.0003), the inhibitory effect can last up to one week (F = 344.59, P = 0.0001).

    2.6 transfected with the recombinant plasmid apoptosis of HT  29

    HT  29 cells transfected with the recombinant plasmid 72h changes of cell apoptosis detected by flow cytometry, as shown in Figure 6. Obvious apoptosis peak the (Sub  G1 peak) blank control group and negative control group, most of the cell cycle in the G1 phase of the normal cell growth and division, and transfected with the recombinant plasmid HT  29 cells, apoptosis rate recombinant plasmid group was significantly higher than the control group (F = 24.71, P = 0.0013) (0.3000 ± 0.2000%) (0.2667 ± .2082%) and (7.0667 ± 2.3459%) transfected COX  2 siRNA recombinant plasmid can directly induce HT  29 cell apoptosis. Table A value of 2 MTT assay after transfection, cells in each group

    2.7 RIA assay PGE2 change in the culture supernatant after transfection

    24, 48 and 72 h cells culture supernatant PGE2 content measured after transfection, as shown in Table 3, the results found that the recombinant plasmid compared with the control group, 24h after transfection PGE2 did not change significantly (F = 0.29, P = 0.7552), but decreased from 48h to start content (F = 11.71, P = 0.0085), 72h decreased significantly (F = 82.23, P = 0.0001), the difference was statistically significant. Table Comparison of 3 cells in each group at different time supernatant PGE2 (pg / ml)

2.8 ELISA assay of VEGF in the cell culture supernatant change

    24, 48 and 72 h cells culture supernatant VEGF concentration measured after transfection, as shown in Table 4, the results found in the recombinant plasmid group 24h supernatant VEGF levels compared with control group did not change significantly (F = 1.9828, P = 0.2182), from 48h to start content decreased, the difference was not statistically significant (F = 4.89, P = 0.0549), 72h decreased significantly, the difference was statistically significant (F = 136.31, P = 0.0001). Table 4 in each group at different time supernatant VEGF (pg / ml) Comparative

    3 Discussion

    Cyclooxygenase (cyclooxygenase COX) is the rate-limiting enzyme of the arachidonic acid metabolism in the cyclooxygenase pathway, 1991, confirmed the existence of two isozymes [5]: structural expression of COX  1 and inducible COX  2. The expression of the former in a variety of human tissues and cells, the main regulator of the physiological prostaglandin synthesis, the low level of the latter in the normal tissue, and its expression by many of the intracellular and extracellular stimuli factors in the pathophysiological response to process, inducing generated [6]. In recent years, many studies have shown, COX  2 is highly expressed in colorectal cancer [7]. COX  may promote angiogenesis, accelerated tumor cell proliferation, inhibition of apoptosis, plays an important role in the tumor development process [8-9]. It has been reported that the antipyretic analgesic use of non-steroidal drugs (NSAIDs) can inhibit colon cancer growth, which may be related to the inhibition of COX  2, but due to the presence of the non-COX  dependent anti-tumor mechanism of action, NSAIDs exact antitumor the mechanism is not completely understood [10  12]. In order to further study the COX  2 gene with colon cancer relationship, some previous studies the use of knockout, antisense oligonucleotide and other COX  2 inhibitors, have certain defects, the results are not very satisfied Therefore, in the present study, we used a new technology to study gene function, RNAi technology [13].

    RNAi in Caenorhabditis elegans found and named the 1998 study by Fire and Mello [1,14], which was higher than any of the separate use of antisense RNA-induced gene silencing efficiency 10-fold [15], 2001 Elbashir [16 ] research confirmed that the application of RNAi technology in mammalian cells, has opened a new chapter in the RNAi in mammalian cells research, “Science" magazine RNAi will be referred to as “a major breakthrough in 2002 [13]. Long dsRNA can cause non-specific inhibition of gene expression in mammalian cells, since the only the 19  23nt of the siRNA is capable of inducing RNAi, siRNA can be efficiently and specifically block the expression of homologous genes in mammalian cells [17], so RNAi technology is ideally suited for research and block the abnormal gene or protein expression in tumor cells, may play a role in inhibiting tumor cell proliferation and promote apoptosis of tumor cells [18  19]. siRNA transcription by chemical synthesis, plasmid or viral vectors [20] In contrast, the plasmid vector transcription of siRNA is cheaper, safer, easier to operate, more suitable for long-term study of the function of the tumor oncogenes The carrier may be, especially with the antibiotic marker, inhibition of target gene expression in mammalian cells continued role for several weeks or even several months [2,21].

    Eukaryotic expression for this study based on RNA interference principle, in accordance with the design principles of the siRNA [3  4], using containing transcriptional promoter H1 eukaryotic cells and in prokaryotic and eukaryotic cell level, respectively positive clones Resistance Screening carrier pGPH1  GFP  Neo siRNA for COX  2 gene design to connect, build recombinants. Excluded homology with all other human genes in an existing gene library may therefore have a high degree of specificity in the choice of target sequence using BLAST. Successfully build recombinant transcription vector pGPH1  GFP  Neo  COX  2, after the liposomes transfected into human colon cancer HT  29 cells, fluorescence microscopy results plasmid successfully imported of HT  29 cells and be successful expression, followed by the use of the by RT  PCT and Western blot, respectively, from the transcription and protein levels of discovery transfected with the recombinant plasmid 24 and 48h HT  by 29 cell expression of COX-2 expression has not significantly down-regulated 72h after transfection COX  2 expression was significantly inhibited, inhibition can be continued until one week after transfection. Also found that COX  2 gene is silent of HT  29 cells after 72h growth significantly inhibited flow cytometry analysis confirmed that the recombinant transfection group HT  29 cell apoptosis rate increased significantly, which further prove that the expression of COX  2 in promoting plays an important role in the growth of colon cancer cells and anti-apoptotic, can inhibit the growth of colon cancer cells by inhibiting the expression of COX  2, but the anti-apoptotic effect of COX  2 gene may be involved in a lot of ways, pending further study [12].

    The study also found that by blocking of HT  29 cells COX  2 gene expression, decreased cell synthesis of PGE2, it has now been confirmed PGE2 in tumor growth, proliferation, and increased invasive play an important biological role [22], inhibit PGE2 positive feedback role in the generation, can affect the growth of colon cancer cells, PGE2 synthesis decrease, also blocking PGE2 on COX  2 expression [23]. Promoting the tumor vasculature factor [24], PGE2 EP receptor / CAMP signaling pathways to promote tumor cells to produce VEGF, this study found that VEGF production of recombinant plasmid transfected cells was significantly reduced and may be reduced PGE2 synthesis, and then blocking the signal pathway provides a theoretical basis to explain the role of NSAIDs in the anti-tumor vascular.

    Constructed in this study targeting COX  2 siRNA eukaryotic expression vector can significantly inhibit human colon cancer HT  29 cell expression of COX  2 expression, the role of sustained, specific and entirely colon cancer cells COX  2 gene silencing can inhibit cell growth and promote tumor cell apoptosis, inhibition of PGE2 synthesis and reduce the production of VEGF, which will help to inhibit the formation of tumor blood vessels, to further study the relationship between COX  2 colon cancer, clarify NSAIDs anti-tumor effect, provides a new strategies and approaches, it is foreseeable tumor targeting cancer gene silencing siRNA expression vector technology is expected to become a powerful tool for cancer gene therapy [25  26].