【Abstract】 Objective To study the of Ezrin protein on prostate cancer cell proliferation and athletic ability. PC  3 cell lines of prostate cancer as an object of study, design small interfering RNA fragments for the Ezrin protein coding sequence, recombinant shRNA expression vector was transfected into cells stably expressing cell clones screened by RT  PCR and Western blot, respectively. detection Ezrin expression changes in gene and protein level, with four methyl thiazolyl tetrazolium (MTT) assay proliferative capacity, flow cytometry cell cycle Transwell assay invasion ability. Results PCR and Western blot showed that shRNA Ezrin in gene and protein levels showed a significant downward effect after transfection of prostate cancer cell growth has slowed significantly, and the cell cycle shows the proportion of cells in mitosis (24.58 ± 4.23)% (18.65 ± 2.21)%, in the number of cells in the G1 phase by (58.69 ± 3.48)% rose to (66.54 ± 4.13)%. The number of cells passing through the artificial basement membrane is also reduced (38.6 ± 5.4) (24.5 ± 2.7) (P <0.01). Conclusion Ezrin prostate cancer cell proliferation and athletic ability may be an important target for cancer treatment.

Key words expression of Ezrin; shRNA; prostate cancer

Influence of Down  regulate of Ezrin Expression by RNAi on Proliferation and Invasion of Prostatic Carcinoma

    XIE Bo  zhen, CHEN An  min, GUO Feng  jing, SONG Deng  xin, ZHU Bo, QI Jun, CHEN Chao

    Department of Orthopedics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China

    Corresponding Author: CHEN An  min, E  mail: amchen@tjh.tjmu.edu.cnAbstract: Objective To investigate the effect of Ezrin on the proliferation and invasion of human prostatic carcinoma. Methods Human prostatic carcinoma cell line PC  3 was cultured . A plasmid of a short hairpin RNA targeting Ezrin was constructed, and it was transfected into PC  3 cell line. The expression of Ezrin mRNA and protein were examined by RT  PCR and Western blot method respectively. The proliferation was examined by MTT. Flow cytometry was used to detect the changes of cell cycle. Transwell test was used to detect the invasion ability of PC  3. Results RT  PCR revealed that Ezrin shRNA notably down  regulated expression at mRNA level (P <0.01). Western blot also revealed notably down  regulated expression at protein level (P <0.01). The proliferation was inhibited after RNAi treatment. The cell proportion in G2  M phase decreased from (24.58 ± 4.23)% to (18.65 ± 2.21)%. The cell proportion in G1 phase increased from (58.69 ± 3.48)% to (66.54 ± 4.13)%. The invasion ability decreased from (38.6 ± 5.6) to (24.5 ± 2.7) (P <0.01). Conclusion Ezrin is necessary for human prostatic carcinoma cell proliferation and invasion. It is probably an important factor to inhibit tumor.

    Key words: Ezrin; shRNA; Carcinoma of prostate

Prostate cancer has a high tendency to bone metastases, approximately 70% of patients died of bone metastases. Prone to prostate cancer bone metastasis mechanism is not completely clear. Ezrin belong to the family of proteins of the ERM (Ezrin / Radixin / Moesin), a cell membrane cytoskeleton coupled protein, both involved in cell growth, but also in the regulation of the extracellular signal to the rearrangement of cytoskeletal proteins, increased cell motility, leading to tumor metastasis [1]. Study Ezrin film  cytoskeleton protein prostate cancer PC  3 cell lines Ezrin expression levels reduced by RNAi, Cell Biology detect interference behavior change, explore Ezrin protein on prostate cancer cell growth and athletic ability provide a theoretical basis for the impact of prostate cancer bone metastasis.

    1 Materials and methods

    1.1 cell line

    Human prostate cancer PC  3 cell lines, by Dr. Liao Hui of the room. Cell culture conditions: 37 ° C, 5% CO2, RPMI 1640 medium (Hyclone) +10% fetal bovine serum (Bioind) +500 μg / ml G418-.

    1.2 small interfering RNA expression vector design and build

    In GeneBank retrieve people Ezrin full-length gene coding sequence, 5 ‘ ATGCTATGTTGGAATACCT  3’ for interference target Dharmacon website small interfering RNA sequence online design tool. In vitro synthesized with BamH Ⅰ and Hind Ⅲ sticky end restriction sites at both ends, containing 5 ‘ ATGCTATGTTGGAATACCT  TTCAAGAGA  AGGTATTCCAACATAGCAT  3’ hairpin-like sequences of double-stranded DNA fragments of the synthetic access pSilence2.1  neo vector and transformed into Escherichia coli DH5α, filtering, amplification, sequencing confirmed successfully constructed. 5 ‘ GACTTCATAAGGCGCATGC  3’ as a negative control sequence the same vitro synthesis with BamH Ⅰ and Hind Ⅲ sticky end restriction sites at both ends, containing 5 ‘ GACUUCAUAAGGCGCAUGC  TTCAAGAGA of  GCATGCGCCTTATGAATTC  3’ hairpin-like sequence double-stranded DNA, the synthetic fragment access pSilence2.1  neo vector transformed into Escherichia coli DH5α, filtering, amplification, sequencing successfully constructed. Transfection reagent used Lipofectamine2000TM for (Invitrogen Corporation, USA), pursuant to the operating instructions. Divided into four groups of cells transfected: blank group, liposome group, the experimental group, negative control group. G418 selection concentration of 800μg/ml, 500μg/ml concentration to maintain selective culture.

    1.3 Extraction of total cellular RNA and RT  PCR

    The total cellular RNA extracted using Trizol reagent (Invitrogen), and subjected to reverse transcription reaction. PCR primers Ezrin: 5 ‘ CCCTCCAGTTCAAGTTCC  3’ (upstream), 5 ‘ AAGCCAAAGGTCTGTTCC  3’ (downstream), the amplified product of 431-bp internal reference the GAPDH: 5 ‘ GAAGGTGAAGGTCGGAGTC  3’ (upstream), 5 ‘ GAAGATGGTGATGGGATTTC  3 ‘(downstream) amplification product of 226bp. PCR conditions: 95 ° C 5min at 94 ° C for 50s, 59 ℃ 50s, 72 ℃ 1min (cycle 32). The PCR product was purified by 2% agarose gel electrophoresis test results. RT  PCR conducted a total of four times, each set of five parallel holes, averaging calculation.

    1.4 Western blot analysis

    Total cellular protein was extracted by 12% polyacrylamide gel electrophoresis (SDS  PAGE) and then transferred to polyvinylidene fluoride (PVDF) membrane, 10% skim milk powder closed 1H, an antibody was diluted 1:1 000 Ezrin (United States the company CST) and of β  actin (American company CST). The second antibody was horseradish peroxidase-labeled IgG was diluted 1:1 000. PVDF membrane sequentially with antibodies of reaction and Western blot chemiluminescence (ECL). X-ray exposure, development, and analysis after fixing. Repeat 4 times, each set of 5 parallel samples, take the average.

    1.5 methyl thiazolyl tetrazolium blue (MTT) method to measure cell proliferation

    After the transfected cells were seeded in 96-well plate, seeding density of 0.5 × 104 / hole, daily MTT reaction measured 540nm absorbance values ​​measured continuously for 10 days. Draw the curve after transfection cells transfected with the growth rate before the change. Repeated 4 times, each hole is provided to five parallel holes, to calculate the average value of absorbance.

    1.6 flow cytometry cell cycle and apoptosis

    Expanded cells and non-transfected cells collected after transfection of each 1 × 106, 70% ice ethanol, propidium iodide (PI) staining to determine the cell cycle and apoptosis. Was repeated 4 times, and each sample of five parallel tubes, take the average value calculation.

    1.7 Transwell the assay cell invasion force

    The pore size of 8μm 24 holes the Borden small chamber (BD Biosciences). Produced basement membrane of the 1:3 dilution of the Matrigel gum (Sigma, USA), the upper chamber added 1 × 105 cells, a total volume of 200 μl, the lower chamber added 300μl serum-containing medium, 37 ℃ culture were observed after 24h, counting the basement membrane number of cells in the lower chamber, under a microscope at 200 times for random selection of six fields of view are counted, and the average for the number of cells through the basement membrane. A total of four times, each set of 5 parallel samples.

    1.8 statistical methods

    The experimental data were analyzed using Microsoft Excel and SPSS processing, MTT and Transwell results using a paired t-test.

    2 Results

    2.1 plasmid cells transfected PC  3 cells were transfected plasmid carrying the shRNA screening growth in good condition, the transfection efficiency of about 75%, after amplification was observed under a fluorescence microscope visible cells carrying green fluorescent, see Figure 1.

    2.2 transfected target gene and protein expression RT  PCR and Western blot the more obvious shRNA downregulation of the Ezrin gene and protein level, as shown in Figure 2. RT  PCR results show that the negative control group Ezrin gene expression gray value (2 409.156 ± 54.315), the interference group Ezrin gene expression gray value (195.517 ± 12.369) (P <0.01), compared with GAPDH The silencing efficiency was about 90%. Westernblot results show that the negative control group Ezrin protein expression levels (96.21 ± 10.26), the interference group Ezrin protein expression levels (19.59 ± 1.12) (P <0.01).

    2.3 MTT assay PC  3 cells interfere with the proliferation of the situation before and after the change

    According to the experimental group and negative control group cells absorbance values ​​measured for 10 consecutive days, the cell growth curve, and value for statistical analysis, found down Ezrin protein can significantly slow down the PC  3 cell proliferation. Initial value (0.082 ± 0.003), the experimental group cells on the fifth day (0.160 ± 0.011), while the negative control group liters

    2.4 flow cytometry cell cycle and apoptosis

    The results show that the cell cycle of the tumor cells after disturbance subject to a significant impact proved Ezrin  shRNA PC  3 cells after transfection can inhibit proliferation. The average proportion of cells in mitosis (24.58 ± 4.23)% decreased to (18.65 ± 2.21)%, while the proportion of cells in G1 phase average increased from (58.69 ± 3.48)% to (66.54 ± 4.13)%, as shown in Figure 4.

    2.5 Transwell detect cell invasion

    Can be found by counting the experimental group and the control group cells through artificial basement membrane cell number and compare down Ezrin protein, decreased invasive ability of tumor cell movement through artificial basement membrane cells significantly reduced the number from ( 38.6 ± 5.4) to decrease (24.5 ± 2.7) (P <0.01), as shown in Figure 5.

    3 Discussion

    The cytoskeleton is in the cytoplasm of eukaryotic protein fiber grid system. It plays an important role for the cell shape, cell motility, the transport of substances within the cells, chromosome segregation and cell division. Changes in the cytoskeleton prevalent in many malignant cells, it can lead to changes in cell motility, and athletic ability of the tumor cells enhanced tumor distant metastasis important prerequisite. Ezrin belongs to the ERM family of proteins, exists in almost all cells, physiological state, Ezrin to maintain cell polarity, involved in cell motility, cell and cell-ECM adhesion, regulation of immune cell function, and cellular senescence death [2] . Have been identified in lung cancer, breast cancer [3], esophageal cancer [4], Ezrin expression in gastric cancer cells was significantly higher, and recognize that Ezrin expression increased with tumor metastasis is closely related.

    The study used RNA interference to the downregulation of Ezrin. RNA interference is in recent years the use of more of the methods for gene research, with high specificity and efficiency, etc. [5]. Carrying shRNA plasmid expression vector to produce a sustained downward effect of the target gene. The study found that the Ezrin gene has reduced by around 90%, lowered the rate of about 80% of the protein level, prove that the shRNA expression vector effective means of continuing downward Ezrin. RNA interference cells, proliferation rate has a significant reduction in the ability of the cells through a reconstituted basement membrane is also significantly decreased. These showed that down Ezrin significantly inhibited the growth and invasiveness of tumor cells. This result is consistent and Yu [6] results in pediatric rhabdomyosarcoma. Ezrin’s RMS cell lines transfected Ezrin low expression, they can significantly stimulate the nude mice with lung metastasis. Khanna et al [7] in the guinea pig model of osteosarcoma study the Ezrin express high K7M2 osteosarcoma cell line than Ezrin expression the low K12 cell lines with stronger invasiveness and metastasis of tumor formation ability.

    With the understanding of the law governing the growth of tumor cells, combined with comprehensive cancer treatment such as radiotherapy, chemotherapy, biological therapy with surgery, the 5-year survival and quality of life of the malignant tumors have a significantly improved However, recurrence and metastasis is still the major obstacle to obstruct further enhance the therapeutic effect. A lot of the basic research to clarify the relevant factors for prostate cancer recurrence and metastasis. Ezrin as key molecules directly involved in cell motility, played an important role in the proliferation and invasion of tumor. The study shows that, down Ezrin can significantly inhibit the proliferation and invasion of tumor the Ezrin protein may become important target for clinical treatment of cancer. On the basis of of in vitro, in vivo tumor suppression experiments have a good theoretical basis.