Abstract Objective To investigate the relationship of the nucleotide excision repair (XPD) gene single nucleotide polymorphisms and the risk of non-Hodgkin’s lymphoma (NHL). The method for the study of 309 patients with NHL and 305 healthy controls, using PCR  RFLP detected XPD G23591A polymorphism genes A35931C sites. The results of a preliminary analysis of the XPD G23591A, and A35931C genetic polymorphisms with overall NHL was no significant correlation. Analysis of the NHL subclasses in follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), other B-cell NHL and T-cell NHL, XPD 23591 sites GA + AA genotype frequency 16.3 0.05);XPD35931位点AC+CC型频率分别为">%, 18.0%, 10.5%, and 18.4% in the control group was 12.5%, OR values ​​were 1.43,1.58,0.89 and 1.50, the difference was not statistically significant (P> 0.05); XPD35931 sites AC + CC frequencies were 0.05)。">15.2%, 15.8%, 18.4%, 12.5%, the control group was 11.5%, OR values ​​were 1.41,1.48,1.75 and 1.12, the difference was not statistically significant (P> 0.05). Conclusion Han population XPD G23591A G23591A site polymorphism has nothing to do with the incidence of non-Hodgkin’s lymphoma.

Key words non-Hodgkin’s lymphoma; XPD; polymorphism; single nucleotide

    Relationship between XPD Genetic Polymorphism and Risk of Non  Hodgkin’s Lymphoma

    LIU Jie1, ZHU Jing  yan2, SONG Bao1, WANG Zhe  hai1, SHI Yan3, LV Li  yan1

    1. Medical Oncology, Shandong Tumor Hospital, Ji’nan 250117, China; 2. Medical Oncology, Weifang Hospital of Traditional Chinese Medicine; 3.Department of Hemotology, Qilu Hospital, Shandong UniversityAbstract: Objective To explore the relationship between the single nucleotide polymorphisms of XPD (G23591A, A35931C) and individual susceptibility to non  Hodgkin’s lymphoma (NHL). Methods XPD G23591A and A35931C genotypes in 309 NHL cases and 305 healthy controls were detected using PCR  restriction fragment length polymorphism assay.Results No significant association between the G23591A, A35931C polymorphisms and the risk of whole NHL was shown. NHL cases were subsetted into four groups: follicular lymphoma group, diffuse large B  cell lymphoma group, T  cell lymphoma group and other B  cell lymphoma group. XPD 23591GA + AA 0.05); XPD">frequencies were 16.3%, 18.0%, 10.5% and 18.4% in each group, while 12.5% ​​in controls, the ORs were 1.43, 1.58, 0.89 and 1.50, respectively. But no statistically significant difference was shown (P> 0.05); XPD 0.05″>35931AC + CC frequencies were 15.2%, 15.8%, 18.4% and 12.5% ​​in each group, while 11.5% in controls, the ORs were 1.41, 1.48, 1.75 and 1.12, respectively. But no statistically significant difference was shown (P> 0.05 ). Conclusion The XPD genotypes may do not contribute to the risk of developing NHL in shandong area populations.

    Key words: Non  Hodgkin lymphomas; Xeroderma pigmenting group D (XPD); Polymorphism; Single nucleotide

Non-Hodgkin’s lymphoma is a common hematological malignancies, the upward trend in the incidence in recent years. Virus infection, high-dose radiation, contact chlorophenols, pesticides, taking immunosuppressant pathogenic factors [1], the body intrinsic genetic factors, however, are also in the pathogenesis played a certain role. Studies have shown that DNA repair enzymes in the body to defend the invasion of carcinogens, the individuals DNA repair dysfunction suffer increased cancer risk. XPD is an important member of the DNA repair system, at home and abroad have reported that the gene polymorphism with lung cancer, skin cancer and other tumor-associated [2, 3], but on the gene polymorphism with non-Hodgkin’s lymphoma (NHL) A few studies. Case-control method, using restriction fragment length polymorphism analysis, explore Shandong Han population XPD gene polymorphism distribution and its relationship with the risk of NHL. 1 Data and methods

    1.1 Clinical data

    July 2002 to June 2005, the Shandong Provincial Tumor Hospital, Shandong University Qilu Hospital of NHL patients hospitalized 309 cases, 173 cases were male, female 136 cases were Han. Classification of all cases in accordance with the new classification of lymphoid neoplasms WHO standard (2001). 139 cases of diffuse large B-cell lymphoma (DLBCL) and follicular lymphoma (FL) 92 cases, small lymphocytic lymphoma, 15 cases, sets of 10 cases of lymphocytic lymphoma, lymphoplasmacytic lymphoma, 11 cases around T-cell lymphoma, 16 cases, 12 cases of anaplastic large cell lymphoma, a total of 14 cases of other types of. The control group of 305 cases from the same period in the hospital examination in healthy subjects, with NHL patients age, sex distribution, the difference was not statistically significant, are Han. All subjects were informed consent and voluntary participation.

    1.2 Experimental Methods

    1.2.1 peripheral blood genomic DNA extraction

    Both groups take the peripheral blood 1 ml of EDTA anticoagulant, blood sample DNA extraction kit applications Omega Follow the steps to extract the DNA. Stored at -20 ℃.

    1.2.2 PCR  RFLP detection

    Cited material reference literature [4] by the Shanghai Sangon synthesis XPD G23591A bit point of primers upstream 5 ‘ CTGTTGGTGG GTGCCCGTATCTGTTGGTCT  3’, downstream 5 ‘ TAATATCGGGGCTCACCCTGCAGCACTTCCT  3’, product size 751 bp in; XPD A35931C bit point of primer for upstream 5 ‘ GCCCGCTCTGGATTATACG,  3’ downstream 5 ‘of  CTATCATCTCCTGGCCCCC  3’, product size 436 bp in. PCR conditions were 94 ° C for 5 min; 95 ° C for 30 s, 60 ° C for 30 s (XPD G23591A) or 61 ° C. 45 s (XPD G35931A), at 72 ° C for 5 min, 35 cycles; 72 ℃ 10 min. Take 5 μl PCR product is added to the test results of 20 μl containing 5 u restriction endonuclease digestion reaction at 37 ° C to digest 8 h, 3% agarose gel electrophoresis. Application Sty Ⅰ digestion the G23591A sites, resulting in fragments of 507 and 244 bp 2 GG genotype; produce 474,244 and 33 bp fragments for the AA genotype; produce 507,474,244 and 33 bp fragments for the GA type. Application Pst Ⅰ ​​the digestion A35931C sites, to produce fragments of 290 and 146 bp 2 AA type; produce 227,146 and 63 bp fragments for the CC genotype; produce 290,227,146 and 63 bp 4 fragments as AC type.

    1.2.3 Statistical Methods

    NHL and control groups XPD gene locus genotypes were calculated frequency, χ2 test to determine the statistical significance of the genotype frequency difference between the case and control groups. The odds ratio (OR) and 95% confidence intervals (95% CI) to estimate the relative risk. All statistical analyzes application SPSS10.0 software is complete.

    2 Results

    2.1 XPD gene G23591A PCR  RFLP, A35931C site, electrophoretic pattern, as shown in Figure 1.

    2.2 XPD genotype distribution and NHL risk of relationship

    The genotype frequencies by the test case group and control group crowd XPD polymorphic loci meet Hardy  Weinberg equilibrium, determine two samples group representation. XPD G23591A sites GG, GA and AA genotype frequencies in the control group and the NHL group were 87.5%, 11.5%, 1.0% and 83.4%, 15.3%, 1.3%, GA, AA type risk of NHL ( 0.05)。">OR) were 1.430 (95% CI: 0.891 ~ 2.295), 1.429 (95% CI: 0.316 ~ 6.468), the difference was not statistically significant (P> 0.05). The the XPD A35931C sites AC and CC genotype frequencies in the control group and the NHL group were 88.5%, 10.5%, 1.0% and 84.5%, 13.9%, 1.6%. 0.05),见表1。">The AC CC genotype NHL risk were 1.402 (95% CI: 0.860 ~ 2.288) and 1.795 (95% CI: 0.423 to 7.608), the difference was not statistically significant (P> 0.05), as shown in Table 1. Table 1 XPD 23591,35931 locus genotype frequency distribution in the case and control groups

    * OR 2 controls and 2 cases were not amplified 2.3 XPD genotype distribution of various types of NHL risk of relationship gender age-adjusted XPD G23591A:

    Further divided into the NHL follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), four major categories of T-cell NHL and other B-cell type NHL, NHL subgroups XPD 23591 sites GA + AA genotype frequencies were 16.3%, 18.0%, 10.5%, 18.4%, and the control group was 12.5%, the GA + AA Table 2 XPD 23591,35931 locus genotype in different types of NHL and control groups in the frequency distribution * OR value 0.05);XPD35931位点AC+CC型频率分别">gender age-corrected suffering from various types of NHL risk was approximately 1.43,1.58,0.89 and 1.50 times, the difference was not statistically significant (P> 0.05) between the case group and control group; XPD35931 sites AC + CC frequency 0.05),">was 15.2%, 15.8%, 18.4%, 12.5%, and the control group was 11.5% AC + CC genotype prevalence risk 1.41,1.48,1.75 and 1.12 times, respectively, the difference was not statistically significant (P> 0.05). Table 2.

    3 Discussion

    The XPD is located on the 19th chromosome, encoding the ATP-dependent 5 ‘ 3’DNA helicase, an important part of the complex is a the type Ⅱ transcription factor H (TF Ⅱ H), involved in nucleotide excision repair, and can identify and repair a wide range of DNA damage, such as large-adduct and thymine dimers, etc. [4]. The XPD gene G23591A and A35913C of locus gene polymorphism may lead to a corresponding amino acid change caused by differences in individual DNA repair capacity, and may play a role in the incidence of some tumors. Hu et al [2] show 3725 meta-analysis of lung cancer the 23591AA and (or) 35913CC genotype increased risk of lung cancer; Tomescu et al [3] reported that the 35913A allele melanoma incidence increased; FUEL India [5] the XPD 23591A allele and heavy smokers increased risk of suffering from lung squamous cell carcinoma, but did not increase the risk of esophageal cancer. In this study, 309 cases of NHL patients and 305 healthy control subjects for the study analysis XPD23591, relationship the 35913 locus gene polymorphism with NHL incidence. Preliminary analysis shows no significant correlation XPD gene polymorphism and the total incidence of NHL. NHL is a highly heterogeneous tumors, divided into dozens of different subtypes according to the WHO criteria, FL and DLBCL accounts for about 30% and 45%, respectively. We further NHL is divided into four major sub-categories: FL, DLBCL group, the group of other B-cell NHL and T-cell NHL group, XPD genotype frequency analysis showed no statistical difference between the NHL the subclasses and control group significance. The results of this study show that the XPD gene polymorphism did not play a role in the process of non-Hodgkin’s lymphoma cancer.

    This study also shows Shandong Han population in XPD 23591A the 35913C allele frequency of 6.25% and 5.75%, respectively, with Yu et al [6] reported that the Chinese population, Park, etc. [7] reported that the Korean population is similar to the findings, but with the European and North American Caucasian population (about 50%) varied [3,8], indicating the existence of genetic different geographical and ethnic differences. We speculate that the XPD polymorphic Chinese population lower incidence, the gene function, and therefore did not play a leading role in the incidence of non-Hodgkin’s lymphoma. However, we do not rule out the possibility that other DNA repair genes, such as including XRCC1, Relationship between XRCC3, XPA, XPC, XPE, XPF, etc. play a role in the incidence of non-Hodgkin’s lymphoma.