Abstract Objective To construct the expression plasmid for small molecule survivin RNA interference, Research siRNA expression plasmid silence survivin gene on colon cancer cell line SW480 invasive and proliferative effects. Carrier pRNAT U6.1/Neo build the Survivin siRNA expression plasmid (pRNAT / sur  siRNA), and the plasmid transfected SW480 cell line after 48 hours of survivin protein and mRNA expression, with Westeron blot and semi-quantitative RT  PCR analysis changes. G418 400μg / L positive clones were screened cell lines (sur  siRNA/SW480) and MTT method SW480 cell proliferation in vitro changes; the cells invasive experimental study SW480 cells invasive changes. The results successfully build pRNAT / sur  siRNA expression plasmid, and the plasmid significantly reduced SW480 cell survival protein and mRNA expression levels were reduced by 85% and 80%. G418 400μg / L filter out the SW480 cell line transfected pRNAT / sur  siRNA (sur  siRNA/SW480)]; sur  siRNA/SW480 cell proliferation was significantly inhibited, the inhibition rate was 37.4% (P <0.01); cell invasion assay penetrate several shown the sur  siRNA/SW480 cells (153 ± 66) months, while control group pRNAT/SW480, SW480 cells penetrate the number of (505 ± 65), (578 ± 98) cells, sur  siRNA / SW480 cell penetration compared with the control group was significantly reduced (P <0.01). Conclusions survivin siRNA can significantly reduce the expression of survivin and inhibit tumor cell proliferation and invasion, the survivin siRNA sequence may be an effective means of treatment for colon cancer.

Key words survivin; RNA interference; Cell invasion; colon

siRNA Aiming at survivin Inhibit Invasive Ability and Proliferation of Colorectal Cancer Cell Line

    YOU Zhen  bing, HE Jing  dong, Yu Xiao  juan

    Department of Oncology, Huaian First Hospital Affiliated of Nanjing Medical University, Huaian 223300, China

    Corresponding Author: HE Jing  dong, E  mial: hjddoctor@yahoo.com.cnAbstract: Objective To construct expression vectors of small RNA interference aimed at survivin gene and to explore effect of survivin siRNA gene on proliferation and invasive ability of SW480 cell line . Methods A survivin siRNA plasmid (pRNAT / sur  siRNA) was constructed using pRNAT U6.1/Neo vector. After pRNAT / sur  siRNA vectors were transduced into SW480 cell line 48 hours, the expression level of survivin mRNA and protein were measured by semi  quantitative reverse transcription polymerase chain reaction (RT  PCR) and Western blot analysis, the effect of pRNAT / sur  siRNA vectors on SW480 cell line proliferation and invasive ability were evaluated by MTT assay and cell invasion experiment, respectively.Results survivin siRNA expression plasmid (pRNAT / sur  siRNA) was constructed successfully and pRNAT / sur  siRNA down  regulated expression level of survivin gene protein and mRNA dramatically in SW480 cell, 85%, 80% respectively. SW480 cell containing pRNAT / sur  siRNA vectors (sur  siRNA/SW480) was selected by G418 400μg / L. MTT assay showed proliferation of sur  siRNA/SW480 cell was inhibited obviously (inhibition ratio was 37.4%), lower than proliferation of control group cell (P <0.01) . Cell invasion experiment showed that cell numbers of sur  siRNA/SW480, pRNAT/SW480 and SW480 cell, that penetrated membrance, were 153 ± 66, 505 ± 65 and 578 ± 98, penetration numbers of sur  siRNA/SW480 cell was reduced obviously, compare to control groups cell (P <0.01). Conclusion The siRNA aimed at survivin gene could reduce the expression level of survivin gene protein and mRNA, and inhibit proliferation and invasive ability of SW480 cell line. The sequence of RNA interference against survivin may be a validity method to treat colorectal cancer.

    Key words: survivin; RNAi; Invasive ability; Colorectal cancer; Gene therapy

 0 Introduction

    survivin selectively expressed in tumor tissue but not expressed in normal adult tissues, highly expressed in colorectal tumor development [1]. And apoptosis are closely related, but few studies about its colorectal cancer proliferation and invasion [2,3]. Constructed in this study survivin siRNA expression plasmid and transfected into SW480 cells, analysis of the efficiency of survivin siRNA silencing of survivin gene expression plasmid and its colon cancer cell line SW480 cell proliferation and cell invasion. New sequence of RNA interference RNA interference the survivin gene therapy colorectal tumors.

    1 Materials and methods

    1.1 Main material and reagents

    pRNAT  U6.1/Neo carrier (Gene script Corporation), restriction endonuclease Hind III and BamH I (Promega, USA), containing survivin shRNA sequence of nucleotides synthesized by Shanghai Boya Biological Limited, survivin monoclonal antibody (Santa Cruz Biotechnology. Inc.), cells transfected of reagent lipfection 2000 (Invitrogen Life), the total RNA extraction reagent Trizol LS Reagent (Gibco BRL Inc.), cell protein extraction kit (Pik days Biological Company). PVDF membrane was purchased from Pall Corporation. MTT was purchased from Shanghai Biological Engineering Technology Company; RPMI1640 medium were purchased from Sigma; preserving SW480 cells by the laboratory, the SW480 cell culture medium containing 100ml / L inactivated fetal calf serum, 100 KU / L penicillin and chain neomycin RPMI1640 medium. Matrigel (BD PharMingen Company) the Transwell (Millipore Corporation). Other domestic biochemical reagents.

    1.2 pRNAT / sur  siRNA expression plasmid

    The shRNA sequence provided by GeneScript software GeneScript’s siRNA Target the Finder and siRNA Congstruct Builder online design and Survivin gene (NM_001168). the shRNA sequence for CCGCATCTCTACATTCAAGAA start position is 100. siRNA inserted fragment is 76bp, the sequence shown in Figure 1:

    40ng/μl, dilution of the two nucleotide chain according to the 20 μl of the reaction system: 1μl 5 ‘ 3’ nucleotide, 1μl 3 ‘ 5’ nucleotide, 1μl 20 x SSC, 17 μl H2O; annealed according to the following reaction system , 95 ℃ × 10min, 25 ℃ × 1h, product.

    siRNA insertion fragments the insert by Hind Ⅲ and BamH Ⅰ pRNAT  U6.1/Neo carrier, antibiotic screening positive clones sequenced built pRNAT / sur  siRNA expression plasmid.

    1.3 cells transfected accordance with Lipofectamine2000 reagent instructions. SW480 cell line after transfection with serum-free medium were to dissolve pRNAT / sur  siRNA expression the plasmid and pRNAT empty plasmid, the Lipofectamine2000 nucleotide mixed in polystyrene tubes, allowed to stand at room temperature for 30min. G418 400g / L screening positive cloned cell lines (including pRNAT / sur  siRNA expression plasmid SW480 cells).

    1.4 RT  PCR detection of survivin mRNA expression of total cellular RNA was extracted with TRIzol spectrophotometer total RNA of the cells in each group A260/A280 1.90 to 1.96; separated by electrophoresis of total cellular RNA, we can see a clear 28s and 18s RNA belt, and the the 28s RNA brightness is 18s brightness of 1.5 to 2.0 times. RT  PCR for the two-step method. Reverse transcription of the total system 20μl, 1μg of total cellular RNA. 10min at 30 ° C, 42 ° C 30min first strand cDNA synthesis, 99 ° C 5min inactivated AMV reverse transcriptase. The PCR reaction was 50μl. survivin upstream primer: 5 ‘ TTCATCCACTGCCCCACT  3’; downstream primer: 5 ‘ CCTTTCCTAAGACATTGCTAA  3’. PCR conditions: denaturation at 94 ° C for 30 s, 50 ° C annealing 30s, 72 ° C extends 90s, a total of 32 cycles.

    β  actin as a loading control, primers 5 ‘ CGTGCGTGACATTAAGGAGA  3’ downstream primer 5 ‘ CACCTTCACC GTTCCAGTTT  3’ fragment of 233 bp.

    1.5 Western blot to detect the expression of survivin protein in cell lysates extracted cytoplasmic protein, the main component of the cell lysates of 20 mM Tris (pH 7.5), 150 mM NaCl, 1% Triton X  100, EDTA, EGTA, sodium pyrophossphate , β  glycerophosphate, Na3VO4, leupeptin. PMSF was added within a few minutes before use to a final concentration of 1 mM. Bradford protein quantitation method for protein quantitation. Taken 20μg of protein extracted by 15% sodium dodecyl sodium sulfate  polyacrylamide gel electrophoresis separation, the constant voltage of 100V 1H electrically transferred to a polyvinylidene fluoride (PVDF), blotting membranes. BSA closed 1h, rabbit anti-human survivin polyclonal antibody (1:200 dilution) for an anti-shaker at room temperature, combined with 2h; the TBST wash the film and then with goat anti-rabbit IgG (1:1 000 dilution) for two resistant, TBST (TBS added 0.05% Tween20) washing the membrane with chemiluminescence color.

    1.6 MTT assay cell proliferative

    0.25% trypsin digestion in the logarithmic growth phase of sur  siRNA/SW480 cells, pRNAT/SW480 cells, SW480 cells, the culture medium with 10% calf serum to prepare a single cell suspension (5 × 105 / mL) cultivate 24h replacement supernatant serum-free culture medium, seeded in 96-well culture plate (100μl / holes) continue to 48h. Each set of six holes, MTT (5mg/ml) 10μl / well in the termination of the train before 6h, the end of the culture, 20% SDS100 μl / well, crystals fully dissolved the next day with the enzyme-linked immunosorbent tag analyzer each hole of 570nm wavelength absorbance A value (A570). The cell growth inhibition rate calculated by the following formula: cell growth inhibition rate of R = [1 – (experimental group A / A blank group)] × 100%.

    1.7 cell invasion assay

    Determination of the ability of the cells in vitro invasion in a 12-well plate Transwell chamber. Matrigel (BD PharMingen) 50μl with serum-free DMEM medium was diluted 1:1 by adding the Transwell chamber surface of the polycarbonate film (12.0μm membrane pore size) at room temperature, dried in a hood and 1H. The the sur  shRNA/SW480 cells, pRNAT/SW480, SW480 cells washed with PBS three times, after digestion resuspended free DMEM medium with 10% FCS, take 1 × 106/ml cells 500μl first chamber Transwell culture plates The lower chamber was added to 1 000μl of DMEM medium containing 10% FCS. 37 ° C, the volume fraction of 5% CO2 conditions, cultured 24h, 4% formalin fixed underwent Gimsa staining. Removal of the the membrane upper cell, with a neutral resin membrane seal on the slide. Microscope (× 400) the count membrane under the surface of the invasion of the basement membrane of the number of cells, were counted the number of cells in the 5 fields of view, each specimen was repeated 3 times, the experiment was repeated three times, to the relative number of invasive cells expressed tumor cell invasion.

    1.8 statistical methods

    T test was used, the data is ± s said, using SPSS11.5 software for statistical processing.

    2 Results

    2.1 build pRNAT / sur  siRNA expression plasmid

    insertion sequence of siRNA 76bp, at both ends for BamH I and Hind III restriction sites by sequencing sequence with the design sequence entirely consistent, as shown in Figure 2, pRNAT / sur  siRNA expression plasmid transfected colon cancer cell line SW480 cells, green fluorescence in the cytoplasm, the pRNAT / sur  siRNA expression plasmid expression correct.

    2.2 survivin mRNA and protein expression

    RT  PCR results showed that the SW480 cell plant height expressed survivin mRNA, pRNAT / sur  siRNA transfected SW480 cells survivin mRNA was significantly inhibited, image analysis shows inhibition of 80%, as shown in Figure 3a. Western blot analysis showed survivin protein expression was inhibited compared with the control group survivin protein expression was significantly decreased by up to 85%, as shown in Figure 3b. PRNAT / sur  siRNA effectively inhibit survivin mRNA expression, which led to decreased expression of survivin protein.

    2.3 MTT assay cell proliferative

    sur  siRNA / SW480 cells the control the group (pRNAT/SW480), SW480 cells in 570nm absorptiometry density OD value and proliferation inhibition rate, shown in Table 1. Visible sur  siRNA proliferation of SW480 cells was significantly inhibited, by up to 37.4%, compared with the control group, a statistically significant (P <0 01).

    2.4 cell invasion

    Microscope scan of the whole film, then take five horizons the sur  siRNA/SW480 of cells, pRNAT/SW480 cells Table 1 pRNAT / sur  siRNA, SW480 SW480 cell proliferation #: P <0.01 cells penetrate respectively 153 ± 66,505 ± 65,578 ± 98  siRNA silencing survivin gene pRNAT / Sur SW480 cells penetrate number decreased significantly reduce that cell invasion, compared with the control group difference was statistically significant. (P <0.01), as shown in Figure 4.

    3 Discussion

    RNA interference (RNA interference, RNAi) is widespread in the biosphere, from low prokaryotes to humans have been found. Refers to a cell mediated specific homologous gene mRNA degradation by double stranded RNA (double stranded RNA, dsRNA) reaction process, the post-transcriptional gene silencing [4]. The antisense nucleotide RNA interference suppression of target gene specificity and efficiency compared with more than 10-fold higher, RNAi is widely used in the field of cancer gene therapy [5,6]. survivin apoptosis inhibitory protein (Inhibition Apoptosis Protein, IAP) one of the members, has powerful anti-apoptotic role in maintaining cell mitosis and angiogenesis regulatory processes play an important role [7] in colorectal cancer induced play an important role in the disease process [1,8]. The observed changes in the biological characteristics of colon cancer cell line SW480 cell survivin gene silencing using RNA interference technology. In this study, based on the survivin gene sequences, design, synthetic fragment of survivin mRNA-specific RNA interference, and cloned into pRNAT  U6.1/Neo carrier, built survivin shRNA eukaryotic expression plasmid (pRNAT / Sur  siRNA). Sequencing validation and pRNAT / sur  siRNA recombinant plasmid green fluorescent protein expression in transfected SW480 cells were confirmed the correctness of the constructed pRNAT / sur  shRNA recombinant plasmids. The pRNAT / sur  shRNA and empty vector pRNAT by liposome-mediated transfection into colon cancer cell line SW480 SW480 cell lines stably transfected pRNAT / sur  siRNA established by G418 selection RT  PCR studies confirmed survivin mRNA expression by 85% and Western blot analysis confirmed that the survivin protein downregulation 80%, sur  siRNA successfully inhibited the expression of survivin in SW480 cell line stably transfected with pRNAT / Sur  siRNA for further research survivin gene provide the material basis of the biological characteristics of colorectal cancer.

    This study shows that silent SW480 cells survivin gene, tumor cell proliferation was significantly reduced. The mechanism may be survivin gene expression in the G2 / M phase the competitively Cdk4/p16INK4a complex combined to form a the survivin / Cdk4 composite material, the p16INK4a complexes dissociate from complex, thereby activating Cdk2 / Cyclin E, the Rb protein phosphorylation, caused by mitosis and cell proliferation. Survivin downregulation in G1 phase cells increased, while the S phase cells decreased cell proliferation decreased [9].

    Invasive important biological characteristics of malignant tumors, and inhibit tumor cell invasion for the clinical treatment of tumors has far-reaching significance. The study found that survivin in SW480 cells was silence after the invasion ability of SW480 cells significantly reduced, suggesting that survivin expression in colon cancer cell invasiveness. Its possible mechanism survivin is silent after cell cycle arrest at the G2 / M phase affect microtubule assembly of actin filaments [10], and SW480 cells in the the microtubule structure changed circumstances may cause cell visco-elastic coefficient decreases, thereby The cell invasion decline. In addition to inhibition of survivin expression can reduce tumor angiogenesis, thereby inhibiting the invasion of SW480 cells [11,12]. Short siRNA targeting survivin gene may be an effective method of treatment of colorectal cancer.