Abstract Objective selective COX  2 inhibitor celecoxib on radiation-induced DNA damage repair. The detection rate of apoptosis and cell cycle by flow cytometry Sub  G1 law; single cell gel electrophoresis to detect DNA damage and repair. RT  PCR and Western blot analysis of DNA repair gene ku70 ku80 expression. Results celecoxib cycle distribution of HeLa cells did not change significantly, but can cause a dose-dependent apoptosis. celecoxib can significantly increase the rate of radiation-induced apoptosis, dose enhancement ratio (DEF) 3.18,4.16,6.96 60,80,100 μmol / L, respectively. The G2 / M phase arrest while is celecoxib 6Gy X line caused a significant weakening of the role of (radiation group: G2 / M 32.35%, drug radiotherapy group: G2 / M 5.95%); the celecoxib obvious increase in radiation-induced DNA damage, Radiation induced SSB and DSB repair (P <0.05) but can be significantly delayed; celecoxib significantly inhibited HeLa cells ku70 ku80 expression (P <0.05). Conclusion COX  2 selective inhibitor celecoxib on tumor cell radiosensitization mechanism may be related to the inhibition of DNA damage repair, its role may be weakened radiation-induced G2 / M phase arrest and inhibition of DSB reorganization repair enzyme DNA  PK ingredients ku The expression can be achieved.

Key words of Celecoxib; HeLa cells; the radiosensitizer mechanism; cell cycle; DNA damage repair

Effects of Selective COX  2 Inhibitor on DNA Repairing after Irradiation

    XU Hui  ting, YU Shi  ying, XIA Shu, XIONG Hua, ZHUANG Liang

    Cancer center, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China

    Corresponding Author: YU Shi  ying, E  mail: syyu@tjn.tjmu.edu.cnAbstract: Objective To investigate the effects of a selective COX  2 inhibitor  celecoxib on DNA repairing after X  rays irradiation, in order to elucidate the possible mechanism of the radiosensitization of selective COX  2 inhibitor.Methods Human cervical carcinoma cells (HeLa) were cultured in vitro and exposed to different doses of celecoxib for 48h then with and without radiation (6Gy), flow cytometry sub  G1fluorescence parameter line was performed to analyze the change of the apoptosis and cell cycle distribution.The DNA damage and repair were detected by single cell gel electrophoresis assay.Semi  quantitative RT  PCR and Western blot were used to measure the mRNA and protein level of ku70 and ku80 in HeLa cell lines treated with celecoxib.Results Celecoxib had no effect on the cell cycle distribution of HeLa cell lines, but it induced apoptosis increasing dependent on celecocib doses.Radiation  induced apoptosis was enhanced after Hela cells treated with celecoxib (enhancement factor = 6.96 at100μmol / L), and the radiation  induced the G2 / M arrest was markedly 34 The by celecoxib [Radiation group (RT): The DNA damage induced G2 / M 32.35%, 100μmol / L celecoxib + RT: G2 / M 5.95%] by radiation was not increased, but the DNA repair was reduced in Hela cells treated with celecoxib (60μmol / L) for 48h, the mRNA and protein level of ku70 and ku80 were also significantly decreased (P <0.05). Conclusion The results suggest that the possible mechanism of radiosensitization of a selective COX  2 inhibitor was related to inhibition of DNA repair including reduced G2 / M arrest cells and decreased DNA  PK expression.

    Key words: Cyclooxygenase  2; celecoxib; G2  M phase; DNA repair; radiation damage

 Cyclooxygenase (cyclooxygenase, COX) is the rate-limiting enzyme of the arachidonic acid biosynthesis of prostaglandins (prostaglandin, PG), COX divided into COX  1 and COX  2 type. Most malignant tumors were COX  2 over-expression, and its expression level is closely related to tumor development, prognosis and metastasis. The selective COX  2 inhibitors not only has anti-tumor activity in vitro and in vivo tests [1] and clinical trials [2] also confirmed that the tumor has radiosensitizing effect. The the radiosensitizing mechanism is not very clear, and may be lower PGE2 levels, promote apoptosis, change the cell cycle, inhibition of DNA damage repair, inhibition of angiogenesis. In this paper, the human cervical adenocarcinoma HeLa cells were observed the selective COX  2 inhibitor celecoxib on radiation-induced DNA damage repair, designed to further elucidate the COX  2 inhibitor selective radiosensitization mechanism. 1 Materials and methods

    1.1 Materials and instruments

    The Oncology Center Laboratory of HeLa cells by Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology refrigerated; to celecoxib. Powder purchased from Anhui SANRAD Limited; propidium iodide (PI), RNA enzyme A (Rnase A) were purchased from Sigma ; the normal melting point, low melting point agarose (NMA, LMA) were purchased from Gibco Company; RT  PCR reagent Trizol were purchased from Shanghai Huashun Sheng Biological Engineering Co., Ltd., reverse transcription kit, TaqDNA polymerase, dNTP Mix were all American Fermentas products DNA repair genes ku70 ku80 primers were synthesized by the Shanghai race Yum; mouse monoclonal antibody ku70, ku80 purchased from NeoMarkers; FAC Sort flow cytometer (Becton Dickson, USA).

    1.2 Cell culture and treatment

    HeLa cells in logarithmic growth phase, 0.25% trypsin digestion and separation, conventional subculture in RPMI  1640 complete culture medium at 37 ° C, 5% CO2 incubator culture. Cells were divided into a control group, treatment group (celecoxib at 48h), the radiation group (6MV X the line 6Gy), drug radiotherapy group (celecoxib after 48h 6MV X-ray 6Gy), celecoxib press concentration gradient which is divided into 20, 40 , 60,80,100 μmol / L group.

    1.3 Sub  G1 assay by flow cytometry cell cycle distribution and apoptotic rate

    Per hole 105 cells were seeded in 6-well plates until after 24h with different concentrations of celecoxib to a final concentration 20,40,60,80,100 μmol / L, blank group received an equal volume of DMSO for 48h The cells were harvested and fixed in 80% ice ethanol,  20 ℃ fixed overnight. Ibid 6 separate the concentration group celecoxib after 48h to 6MV X the line 6Gy irradiation processing, fixed cells cultured for 24h after harvest. After fixation cells were washed with PBS 2 times, 100μl PC buffer and incubated on ice for 30min. PBS washed cells, plus 10mg / LPI10μl 50mg/mlRnaseA10μl, PBS500μl at room temperature in the dark for DNA staining 20min. By flow cytometry 488nm laser excitation and detection, analysis results the application Cellquest software (Becton Dickson, USA).

    1.4 Single Cell Gel Electrophoresis (single cell gel electrophoresis assay, SCGE) detection of DNA damage

    4 cells (celecoxib only take 60μmol / L group) in each group are located parallel to the control group. The cells in each group was digested and prepared as a the PBS single cell suspension (5 × 105 / mL), and after the treatment, respectively in 0,15 min, 30min, 1H, 2H time point charge cell suspension was put on ice. Alkaline single-cell gel electrophoresis to detect DNA single-strand breaks (SSB): reference Singh, NP [3]’s method slightly modified. Shop will be charged each time point, cells within 30min into the attached slide agarose gel, 4 ℃ 15min the glue completely solidified. After the plastic sheet is immersed in the alkaline cell lysis solution (2.5M NaCl, 0.1 M EDTA, and 1% Tritox  100,10% DMSO) 4 ° C protected from light for 2h or overnight; cracking process after the slides with distilled water washed 2 times, placed in the the helicases solution (0.3mol / L NaOH), 4 ℃ dark stand for 20min. Then slides to be filled with fresh cold electrophoresis buffer horizontal electrophoresis tank 25V, 300mA electrophoresis for 25min. 10min in buffer stop electrophoresis after slides distilled water and soft water for 2 to 3 times, after dropping slightly dry concentration of 20μg/ml of ethidium bromide 50μl / piece coverslip on wet box camera save 2 days. Neutral single cell gel electrophoresis assay DNA double-strand breaks (DSB): glue with the alkaline single-cell gel electrophoresis. The prepared plastic sheet placed with neutral Lysates (2mol PL of NaCl, 30mmol / L EDTA, 1% sodium dodecyl sarcosinate, sodium, 10 mmol / L Tris, 1% of Triton X of  100,10% DMSO, pH8.2 ~ 8.5) at 4 ℃ cracking 2h or overnight; 0.5% TBE (2mmol/LEDTA, 90mmol / L Tris, 90mmol / L of boric acid, pH8.2-8.5) immersion rinsed 3 times, each 1H; containing 0.5% TBE electrophoresis buffer horizontal electrophoresis tank 0.6V/cm, electrophoresis 25min; After the alkaline single-cell gel electrophoresis method. Under a fluorescence microscope observation of 100 cells per sample, CASP the Comet Assay Software Project comet image analysis, calculate the the group comet’s Oliver tail moment (Oliver Tail Moment, OTM, tail DNA percentage migration DNA density) .

    1.5 Semi-quantitative RT  PCR

    Analysis dose group (60μmol / L celecoxib role 48h), blank group HeLa (only quite DMSO) cells ku80, ku70 mRNA expression. RNA extraction and purification reagent instructions to complete and cDNA synthesis and reverse transcription product as a template for PCR amplification.

    The Ku70 primer: 5’CTCTATCGGGAAACAAATGAACCAG  3’25bp (forward), 5’GTATCTGCACAATGCTGCAACCTCC the  3’25bp (reverse), annealing temperature 54 ° C, amplification products 339bp; The Ku80 primer: 5’TATGCTCCCACCGAGGCACAGTTGA  3’25bp ( forward), 5’ACTGCCTTCAGCCAGACTGGAGACG  3’25bp (reverse), annealing temperature of 56 ° C, amplification products 478bp; β  actin primers: 5’cctagaagcatttgcggtgg  3 ‘the 20bp (Forward), 5’gagctacgagctgcctgacg  3 ‘the 20bp (reverse), annealing temperature of 56 ° C, amplification products 416bp. PCR products were separated on 1.5% agarose gel electrophoresis, and observed and photographed under UV light.

    1.6 Western blot detection

    Dose group (60μmol / L celecoxib role 48h) and blank group HeLa (only to considerable DMSO) and total protein was extracted. Specific methods are as follows: cold PBS solution was washed three times, and the amount of cell lysis solution (150 mmol / L Tris-Cl, 0.02% sodium azide, 0.1% SDS, 100μg/ml PMSF in 1μg/ml Aprotinin, 1% NP40, 0.5% sodium deoxycholate, 150mmol / L NaCl) lysis to extract the total protein, with a 10% separating gel do SDS-PAGE, and then transferred to NC membrane, 5% skim milk TBST closed 1H at room temperature, were added to an anti-4 ° C incubation The overnight, TBST washed 10min × 3 times, horseradish peroxidase secondary antibody at room temperature incubated for 1.5h, the TBST was washed 10min, washed 3 times with the ECL exposure reagent cartridge exposure backsheet developing.

    1.7 statistical methods

    The above experiments were repeated three times, and among groups using t test and analysis of variance, the data analysis by SPSS11.0 software.

    2 Results

    2.1 celecoxib ray celecoxib separate and combined effects HeLa cell cycle and apoptosis rate changes alone after 48h cycle distribution of HeLa cells did not change significantly, but celecoxib can cause dose-dependent apoptosis in HeLa cells, as shown in Table 1 . Table 1 celecoxib on cell cycle and apoptosis rate

    celecoxib + radiation group compared with radiotherapy alone group, can significantly improve the rate of radiation-induced apoptosis in celecoxib concentration 60,80,100 μmol / L, respectively 3.18,4.16,6.96 times enhance radiation-induced apoptosis rate. Significantly weakened the role of celecoxib 6Gy X line caused G2 / M phase arrest, as shown in Figure 1.

    2.2 celecoxib ray combined effects of DNA damage in HeLa cells

    0.05),表明适当剂量的celecoxib(60μmol">2.2.1 alkaline single-cell gel electrophoresis assay the HeLa cells SSB in Table 2 shows, blank group dosing group SSB injury between the difference was not statistically significant (P> 0.05), show that the appropriate dose of celecoxib (60μmol / L), does not cause significant SSB. 0.05),而药放组照射后各时间点的SSB均高于放射组(P<0.05)">The drugs put group compared with the radiation group, its initial SSB (after irradiation 0min SSB) no difference (P> 0.05), drug put the group irradiated at various time points after the SSB were higher than the radiation group (P <0.05) 0.05),药放组的SSB修复较慢,至照射后2h仍有明显残留的SSB未">; and radiation group SSB 2h after irradiation basic repair (compared with the control group, the difference was not statistically significant, P> 0.05), the drug group, the SSB repair slow to irradiation after 2h still significant residual SSB is not repair.

    0.05);">2.2.2 neutral single cell gel electrophoresis assay the HeLa cells DSB, such as shown in Table 3, similar to the detection result of the SSB, the drug group, as compared with the radiation group, there was no difference (P> 0.05) in its initial DSB; drug radiotherapy group compared with radiation drug radiotherapy group DSB repair speed was significantly lower than the radiation group (P <0.05), 2h drugs put to irradiation group, there are still about 37% of the residual DSB unrepaired.

    2.3 Semi-quantitative RT  PCR method to detect celecoxib HeLa cells ku70, ku80 mRNA expression levels

    The blank group ku70 (1.030 ± 0.066), ku80 dose group (1.335 ± 0.082) mRNA expression levels were significantly higher than ku70 (0.744 ± 0.066), ku80 mRNA expression levels (0.596 ± 0.024) (P <0.05), as shown in Figure 2.

    2.4 Western blot detection of celecoxib HeLa cells ku70 and ku80 protein Table 2 alkaline single-cell gel electrophoresis assay in HeLa cells SSB tail distance (OTM) RT *: Radiation; N = 9; the RT + celecoxib groups with RT * 0.05;RT+celecoxib组与RT*组其余时间点相比,P<0.05;Celecoxib组与Control组相比,P>0.05表3 中性单细胞凝胶电泳法检测">0min compared to group, P> 0.05; RT + celecoxib group and the rest of the time points compared to RT * group, P <0.05; receiving celecoxib compared with the Control group, P> 0.05 Table 3 neutral single cell gel electrophoresis detection HeLa cells DSB tail moment (OTM), results showed that after 48h of cervical cancer HeLa cells were treated with 60μmol / L celecoxib role, ku70 (0.390 ± 0.058), ku80 (0.647 ± 0.120) ku70 protein expression levels than those in the control group (0.785 ± 0.113), ku80 (1.232 ± 0.167) (P <0.05) significantly lowered, as shown in Figure 3.

    3 Discussion

    Existing clinical studies have shown, the radiosensitive tumor expression of COX  2 protein levels are generally lower than the radio-resistant tumors, COX  2 protein expression level was positively correlated with tumor radiosensitivity [4,5]. The in vivo tests and in vitro tests have already proven, non-steroidal anti-inflammatory drugs (NSAIDs) such as indomethacin (indomethacin) or ibuprofen (ibuprofen) can enhance tumor radiation effect. Recent studies have shown that selective inhibitors of COX  2 radiosensitizing effect was significantly higher than the non-selective COX inhibitor, such as, in the same mouse xenograft model, tumor growth delay (tumor growth delay, GD) evaluation criteria, of SC  236 and indomethacin of radiation enhancement factor (enhancement factor, EF) were 3.64 and 1.39 [1,6]. Radiosensitizing mechanism may be related to changes in cell cycle and inhibition of DNA damage repair and inhibit the activity of COX  2, lower PGE2 levels in the cells; promoting radiation-induced apoptosis; The laboratory has confirmed in in vitro and in vivo experiments, celecoxib has radiosensitizing effect on HeLa cells and HeLa cells with high expression of COX  2 expression [7] confirmed in mouse xenograft model. The experimental study of the selective COX-2 inhibitors celecoxib and radiotherapy combined with HeLa cells DNA damage repair.

    3.1 radiosensitive cell cycle

    Cells at different periods, different radiosensitivity of low-LET radiation, the majority of the experiments suggest that in the M phase and the G2 phase of the cell radiosensitivity highest. Raju [8] found that treatment with SC  236 the NFSA (a murine sarcoma cells) can also be caused by the G2 / M phase cell accumulation (67%), while expression of cyclin A, B, and CDK  1 downregulation. In addition, the blockade of PG synthesis may also lead to the accumulation of the G2 / M phase cells. This shows that COX  2 inhibitors selective radiosensitization mechanism may be related to the redistribution of the cell cycle. Petersen et al [9] found by the SC  236 for two days of U251 cell cycle did not change significantly. COX  2 inhibitors also induced cell cycle arrest and tumor cell type or other unknown factors related. The experiment also found that a separate celecoxib HeLa cells does not significantly affect the cell cycle distribution, but allows radiation-induced G2 / M phase arrest was significantly weakened. Figure 4. Similarly, Park et al [10, 11], the study also found that celecoxib can significantly weaken the radiation-induced COX  2 positive cells in the G2 / M phase arrest, and that this effect celecoxib prevents CDK1, CDK2 phosphorylation related.

    Eukaryotic cells after irradiation, can be widely induced G2 arrest occurs, which ensure the integrity of the cell injury, cell survival and maintain the genetic stability of the cells has important biological and genetics significance. Mammalian cells pre-caffeine [12] (can be lifted irradiation-induced cell G2 phase arrest) irradiation treatment, decreased cell survival, radiation-induced cell G2 arrest is the body of a protective regulator. The active state of the CyclinB1  cdc2 complexes play a key role in the regulation of the G2 / M phase process, and is generally considered the ATM / ATR kinases  Chk1/Chk2  cdc25C  cdc2 radiation-induced G2 / M phase arrest. Celecoxib how to affect the way the G2 / M phase arrest deletion and apoptosis-promoting molecular mechanism remains to be further studied.

    3.2 DNA repair and radiosensitivity

    DNA is a major target of the killer cells of ionizing radiation, the radiation-induced DNA breaks and repair, a good correlation with the intrinsic radiosensitivity of cells for cell intrinsic radiosensitivity predictor. Cells are divided low dose radiation, the least part of the cells were sub-lethal damage (SLD), and sublethal damage accumulation in cell survival curves, the performance of the survival curve shoulder shoulder length zone appears DP value (i.e., threshold dose). Raju [8] SC  236 (50uM, 3 days) can eliminate the radiation survival curve shoulder area, and by fractionated irradiation (3Gy / 2 times the interval 4h) prove radiotherapy alone group (1.4) compared to SC  236 + radiation group (1.1) have higher repair capacity.

    The double strand breaks (DSB) is radiation-induced cell death in the most important form of DNA damage and its repair is carried by the two forms of recombinant repair: homologous recombination (homologous recombination repair, HR) and the non-homologous end-binding restructuring (non  homologous end joining, NHEJ), the former is a low form of bioremediation, and higher organisms is the latter. DNA-dependent protein kinase (DNA  PK) is involved in NHEJ important molecules in the repair of DNA damage, the first of its ku subunit combined injury DNA activate DNA  PKcs after start DNA damage repair mechanisms. Has been confirmed that some mammals radiation sensitive cell lines can not be performed DSB repair due to the deletion of the DNA-dependent protein kinase (DNA  PK) component Ku. Lim et al [13] found that COX  2 inhibitors can cut ku70, ku80 both DNA repair gene expression. MD Anderson Raju [14] experiments not only prove celecoxib to inhibit the ku70 expression prove that celecoxib can reduce the binding activity of the DNA  ku protein levels.

    In summary, COX  2 selective inhibitor celecoxib on tumor cell radiosensitization mechanism may be related to the inhibition of DNA damage repair, its role may be weakened by weakening the role of cell cycle G2 / M test points (checkpoint) DSB recombination repair The enzyme DNA  PK ingredients ku expression can be achieved. Celecoxib how molecules affect the cell cycle and DNA damage repair mechanisms have yet to be studied further.