Abstract Objective aristolochic acid-induced bladder cancer model, the effects of curcumin on bladder tissue pathological changes, Ras and p53 protein and cytokeratin 20 (CK20) changes in evaluation of curcumin on aristolochic acid the chemopreventive role and mechanism of induction of bladder cancer. Methods 50 rats were randomly divided into three groups of the control group, the group of carcinogenesis, prevention group. Carcinogenesis group: to give 10mg (kg · d) the aristolochic acid gavage, continuous carcinogenesis three months; prevention group: given feed containing 2% curcumin powder chemical protection while in the carcinogenesis; controls groups: normal diet and drinking water. 3 months after the slaughter of all the rats, take the bladder tissue HE staining under a microscope to observe the pathological changes, Ras, immunohistochemical staining to detect bladder tissue changes in the p53 protein fluorescence quantitative PCR detection of CK20 mRNA. Results After 3 months of carcinogenesis, the incidence of bladder cancer in carcinogenesis group was 95% (19/20), and curcumin prevention group, the incidence rate of bladder cancer was 10% (2/20), the control group bladder mucosa Ras p53 protein and CK20 mRNA was negative, prevention group and carcinogenesis group bladder mucosa Ras p53 protein and CK20 mRNA were positive, and to induce cancer group, the difference was statistically significant (P < 0.001). Conclusion Curcumin aristolochic acid-induced bladder cancer with a good chemopreventive effect of possible molecular mechanism of inhibition of the Ras, p53 protein overexpression ability. Curcumin bladder cancer is expected to become a promising preventive medications.

Key words curcumin; aristolochic acid; bladder cancer; preventive effect

Preventive Effects of Curcumin in Rat Bladder Tumor Induced by Aristolochic Acid

    LI Chao  zhi1, 2,3, QIU Hui1, 2, XIA Yuan  yu3, XIE Cong  hua1, 2

    1.Department of Chemo  Radiotherapy Oncology, Zhongnan Hospital, Wuhan University, Wuhan 430071, China; 2.Hubei Tumor Biological Behavoirs Key Laboratory, Wuhan University; 3.Department of Nephrology, Tongren Hospital, Wuhan University

    Corresponding Author: XIE Cong  hua, E  mail: chxie_65@hotmail.comAbstract: Objective Through observing the pathological change and the change of the Ras protein and p53 protein and cytokeratin 20 (CK20) mRNA in bladder bladder tumor tissue induced by aristolochic acid , to evaluate the preventing effect of curcumin and explore the possible mechanism.Methods Fifty rats were divided into three groups randomly, control group, experiment group and preventive group.The rats in experimental group were given 10mg / (kg · d) of aristolochic acid for 3 months; do the same to the preventive group, and at the same time, added 2% curcumin powder to intervene; the rats in the control group received normal diet and water.After three months all of the rats were sacrificed and the bladder tissue obtained, the Ras protein, p53 protein and CK20 mRNA detected.Results After three months, the incidence of the bladder tumor of the experiment group was 95% (19/20), while that of the preventive group was 10% (2 / 20). The Ras protein and p53 protein and the CK20 mRNA in control group were negative, on the contrary, they were positive in the preventive group and the experiment group.The change of experiment group was obvious, showing statistical significance (P <0.001 ). Conclusion Curcumin had a preventive effect on the bladder tumor induced by aristolochic acid.The possible molecule mechanism was that curcumin can inhibit the over expression of Ras gene and p53 gene.

    Key words: Curcumin; Aristolochic acid; Bladder tumor; Preventing effect

    The many cell experiments and animal trials have exactly the anti-cancer activity of curcumin and anticancer broad spectrum, low toxicity, is a development and application prospects for cancer prevention and treatment of new drugs [1,2].

    Aristolochic acid (aristolochic acid, AA) from aristolochic acid is a plant Asarum plant extract has analgesic, anti-inflammatory, expectorant, diuretic, blood pressure regulation, the antifertility activity and the prevention of radiotherapy-induced neutropenia, and therefore widely used in clinical. However, during use, it is found to contain aristolochic acid drugs often complicated urinary tract tumors, making the carcinogenicity of aristolochic acid has become a new research focus [3]. In this study, the use of aristolochic acid-induced bladder cancer, chemical protective application of 2% curcumin powder feed on rats induced bladder cancer, observed chemopreventive effect of curcumin on aristolochic acid-induced bladder cancer, looking for aristolochic acid-induced bladder cancer chemopreventive agent to provide basic information.

    1 Materials and methods

    1.1 Main reagents aristolochic acid was purchased from SIGMA. The curcumin purchased from Wuhan Chinese and Western instruments the Daquan company, the batch number HB108YHSY, curcumin content ≥ 90%, in the Wuhan University School of Medicine, Institute of Laboratory Animal processed into 2% curcumin powder mouse feed. Ras protein and p53 protein kit (SP  9000/9001/9002 HistostainTM  Plus Kits), purchased from Wuhan Boster Biological Engineering Co., Ltd.. CK20 fluorescence quantitative PCR kit was purchased from Bio-Engineering Co., Ltd. in Shanghai towards the Swiss. The CK20 real-time quantitative PCR using primers synthesized by Shanghai towards the Swiss Biological Engineering Co., Ltd.. Other reagents were analytical grade.

    The 1.2 animal model of choice of 6-week-old Wistar rats of clean grade 50, weight 170 ~ 210g. Divided into a control group (10), carcinogenesis (20), curcumin prevention group (20). Induced cancer group was given 10mg (kg · d) the aristolochic acid gavage to rats intragastrically carcinogenesis three months; prevention group, the same aristolochic acid gavage to rats given 10mg (kg · d), intragastrically 3 months carcinogenesis induced cancer while giving feed containing 2% curcumin powder chemical protection. The control group of normal eating and drinking. Animal feeding in the First Affiliated Hospital of Wuhan University SPF animal laboratory. Slaughter groups all rats, Statistics rat bladder cancer incidence in the end of March.

    1.3 organizations drawn slaughtered the rats quickly take bladder tissue. Part of the bladder tissue rapidly frozen in liquid nitrogen tank to store spare. The remaining bladder tissue was cut into size of about 1cm × 1cm × 0.5cm, 4% paraformaldehyde 20 ~~ 24h. HE staining microscope to observe the pathological changes of the bladder.

    1.4 Immunohistochemical staining cases of bladder tissue were taken 6:00, the SP Series kit instructions Ras, immunohistochemical staining of p53 protein. Negative control anti replaced with PBS, a positive control with the known positive film for staining. Each slice were observed in the overall staining, select five regional representative, counting 200 cells in each district. Statistics of the number of positive cells per 1000 cells, calculate the rate of positive cells. 50%为强阳性。">≤ 10% the number of positive cells was negative, 11% to 30% of a weak positive, 31% to 50% positive for> 50% as strongly positive. Ras protein in the cytoplasm, yellow; p53 protein in the nucleus were brown.

    1.5 quantitative PCR based on extraction of total RNA using TRIzol. By UV spectrophotometer detection and quantification of RNA purity, as a template, a cDNA reverse transcription reaction Oligo (dT) 15 primer, total RNA 3’Poly (A) area guide then cDNA product Moban Realtime PCR reaction. Follow the instructions to establish a quantitative PCR reaction system. In accordance with the reaction conditions, the above reaction system placed in the ABI high-throughput fluorescence quantitative PCR machine 7900HT reaction. The instrument automatically calculates the copy number of specimens CK20 and β  actin / ml, to as CK20 expression levels of CK20 and β  actin ratio. The upstream and downstream primers used in the experiments on the amplification of CK20 gene downstream primers were 5  GGCAGCTGGGCAACAATG  3,5  TCATGATCTCACCCAGGTTCAG  3, amplification of β  actin 5  GCCCTTTCCTGTCCCATTG  3,5  CCAGTCCTGTGT TCGGCCT  3.

    1.6 statistical methods χ2 test method according to the nature of information Ras gene protein and P53 gene protein, CK  20 and the ratio of the reference gene (β  actin) ± s, using t test with SPSS10.0 software for statistical chemical treatment.

    2 Results

    Tumor formation of the difference between the 2.1 different treatment groups shown in Figure 1, after three months of carcinogenesis, the incidence of bladder cancer in carcinogenesis group was 95% (19/20); curcumin prevention group, bladder cancer The incidence rate was 10.0% (2/20), atypical hyperplasia was 20% (4/20), curcumin has good chemical protective role.

    2.2 curcumin bladder mucosa in 10 cases of the control group of the protein p53, Ras gene Ras, p53 gene and protein expression were negative. 20 cases prevention group and 20 cases of carcinogenesis group rat bladder mucosa Ras p53 gene protein were positive, and more obvious to induce cancer group, with statistically significant (P <0.001), Table 1, 2 the Figure 1D ~~ i.

    Comparison of CK20 expression level of 2.3 different groups

    Analysis of Results 2  △ △ CT method for relative quantification. Almost no control group bladder mucosa CK  20 expression, prevention group and induced cancer group the bladder mucosa organizations CK20 expression were increased, the results shown in Figure 2. The t test, prevention group and carcinogenesis group bladder tissue CK20 / β  actin difference was statistically significant (P <0.001); were no significant differences between the control group and the prevention group.

    3 Discussion

    Turmeric is a perennial herb, medicinal parts of the rhizome. Curcumin is the main active ingredient, life as spices and food coloring agent. Wide pharmacological effects of curcumin has anti-inflammatory, antioxidant, anticoagulant, hypolipidemic role, Rao et al [4] reported that the 2000ppm curcumin significantly inhibited azoxymethane (AOM) F344 rats induced colorectal cancer. 2% turmeric can inhibit chemical carcinogenesis induced by skin cancer and gastric cancer [5]. Recently, Sun Ming et al [6] reported that the inhibitory effect of curcumin on bladder cancer cell line EJ. At the same time, low toxicity curcumin, fertile Heungdeok [7] long-term toxicity tests, high doses of 500mg (kg · d), for 80 days, the animals all indices were normal. An oral dose of 600 times while employing the rats were the maximum tolerated dose of test, the animal is no any curcumin in Table 1 for each group p53 gene protein: P <0.001 Ho adverse reactions. Chuang et al [8] reported the results of clinical trials of curcumin a 8000mg / d continuous oral administration of 3 months, the volunteers found no adverse reactions. Curcumin is therefore an ideal bladder cancer chemopreventive drug candidates.

    Aristolochic acid-induced bladder cancer the animal experimental application of curcumin preventable According to literature, feed concentration of 0.05% to 2%, because of its low toxicity, selection of feed containing 2% curcumin powder for prevention, observe the preventive effect of curcumin on aristolochic acid-induced bladder cancer. The HE staining pathological results given curcumin in carcinogenesis, can significantly reduce the incidence of bladder cancer aristolochic acid-induced (95% vs.10.0%). This shows that curcumin aristolochic acid-induced bladder cancer has a good protective effect, can reduce the incidence of bladder cancer, slow down the progress of the tumor.

    Chuang et al [8] the C3H/HeN mouse liver cancer induced by diethylnitrosamine prevention trial with feed containing 0.2% pure curcumin (99.3%), significantly reduced the incidence of liver cancer and multiple rate. Although the animals induced carcinogenesis and tumor is not the same, but with 2% curcumin powder feed aristolochic acid-induced bladder cancer prevention equally good results obtained in Wistar rats. At present, generally believe that [3] AA formation of AA  DNA adducts, the proto-oncogene Ras gene activation occurs A  T transversion mutation, as well as loss of normal function of tumor suppressor gene p53 gene mutations cause proliferation signal enhancement and abnormal cell differentiation, resulting in tumorigenesis. The study found that curcumin induced apoptosis, a possible mechanism of the anti-apoptotic protein (bcl  2, bcl  xl, c  myc, wild-type p53) level is lowered and raised the level of apoptosis proteins (Fas) [9]. The study found that curcumin Ras, p53 gene protein significantly inhibited curcumin on aristolochic acid-induced bladder cancer chemical protective role and Ras p53 gene regulation change, changes in gene regulation may in certain extent reflect the chemopreventive effect of curcumin, its possible molecular mechanism of the inhibition of the Ras, p53 gene protein expression. Because of its low toxicity, inexpensive and so, we believe that curcumin is a promising aristolochic acid-induced bladder cancer prevention drugs.

    CK20, a cytokeratin, mainly in the gastrointestinal mucosal surface of the epithelial cells of the urinary tract (renal pelvis, ureter, bladder delay) mucosal surface cells, the Merkel cells of the epidermis, and specifically exists in these tumor cells of epithelial origin in. As a new bladder tumor markers, by detecting CK20 expression to study the transitional cell cancer has become one of the hot spots in the current [10]. Quantitative PCR method is a novel PCR technology can be used for quantitative analysis [11]. Quantitative PCR endpoint quantitative method different from the conventional fluorescent group is added in the reaction system, the use of the fluorescence signal to the accumulation of real-time monitoring of the entire PCR process. The experimental application of real-time fluorescence quantitative PCR method to detect bladder cancer tissues and normal bladder epithelium CK20mRNA expression analysis using the 2  △ △ CT method for relative quantification results found carcinogenesis group CK20 gene relative changes multiples prevention group was significantly higher than , while in 10 cases of normal bladder mucosa of the control group were almost no expression, the above results confirmed that curcumin has good chemopreventive effect of aristolochic acid-induced bladder cancer.

    Directly reduce tumor incidence as a clinical chemoprevention trial endpoint is unrealistic. As the tumor, further understanding of the molecular and phenotypic changes in the development process, the use of intermediate biomarkers (intermedical biomaker) to reflect the occurrence of tumor development is one of the important indicators to evaluate the chemopreventive effect [12]. The ideal intermediate biomarker should meet the following criteria: (1) and tumor occurrence and development are closely related, to reflect changes characteristic of cancer at all stages; (2) easy to detect, especially in the early changes can be detected : (3) related to the role of the change with the preventive agent. Some indicators such as proliferation, differentiation signals (such as changes in actin, vimentin) and gene / regulation (such as apoptosis, oncogenes or tumor suppressor gene expression) is often used as intermediate biological indicators, evaluation of drug prevention role [13 ]. In this paper, Ras, p53 the genes protein and CK20 as curcumin clinical chemoprevention trial endpoints, evaluation of curcumin on aristolochic acid-induced bladder cancer chemopreventive effect to guide treatment, chemical aristolochic acid-induced bladder cancer the basis of prevention of drug information.