Abstract Objective vitro experiments explore joint application survivin antisense oligonucleotide recombinant fusion protein TP40 has a synergistic inhibitory effect on bladder transitional cell carcinoma T24 cells. Method were divided into a control group, and the wrong sense oligonucleotide group (MS), an antisense oligonucleotide group (AS), TP40 group and joint group (AS + TP40). RT  PCR and Western blot assay of cells in each group of survivin expression; MTT assay of cell growth; groups apoptosis rate by flow cytometry; experimental detection of in vitro tumor cells in vitro non-dependent anchoring Sexual growth capacity. The treatment time is 3 days. The results of synthetic AS (300nM) significantly inhibited the expression of survivin mRNA. Respectively, from the level of transcription and expression levels proved the strongest joint group down survivin. MTT assay showed more pronounced growth inhibition after administration of the combination group (P <0.0001), only 12.2% of the three days of cell viability, apoptosis rate of 96.37%. The TP40 group and the AS group in vitro anchorage-independent growth in soft agarose tumorigenicity in vitro experiments, the ability to greatly reduce the combined group (TP40 + AS) cells barely formed colonies. Conclusion survivin antisense oligonucleotide closed expression of survivin, can enhance TP40 growth inhibition of bladder transitional cell carcinoma T24 cells, synergistic effect.

Key words recombinant transforming growth factor alpha; antisense oligonucleotide; bladder tumor; treatment

 Inhibitory Effect of Recombinant TGF alpha  PE40 Combined with survivin Antisense Oligonucleotides on Bladder Transitional Cell Carcinoma Cells

    YAN Xiang1, DING Qiang2, ZHANG Yuan  fang2, XU Yong  hua3, GUO Hong  qian1

    1.Department of Urology, Affiliated Drum Tower Hospital, Nanjing University, Nanjing 210008, China; 2.Insitute of Urology, Fudan University; 3.Lab of Molecular and Cellular Oncology and Lab of Molecular Cell Biology, Institute of Biochemisty and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of SciencesAbstract: Objective To investigate whether the survivin antisense oligonucleotides could decrease the expression of survivin in vitro and sensitize human bladder transitional cell carcinoma T24 cells to recombinant TGF alpha  PE40 (TP40). Methods The experiment cells were divided into five group, such as control group, survivin missense oligonucleotides group (MS), survivin antisense oligonucleotides group (AS), TP40 group and combined group (TP40 + AS). RT  PCR and Western blot assay was performed to detect the expression of survivin in all groups cells.MTT assay was applied to detect the cell proliferation of all groups.Flow cytometry were performed to detect TP40  triggered apoptosis.The tumor formation experiment of T24 cells in vitro was used to evaluate all groups cells’ independent ability of anchoring growth.Results The survivin antisense oligonucleotides could down  regulate the expression of survivin at a concentration of 300nM.We have demonstrated from the mRNA level and protein level that the combined group could down  regulate the expression of survivin compared with the non  combined group powerfully.In the third day, the survival rate of the combined group cells was only 12.2%, the apoptotic rate was 96.37%, and the ability of tumor formation in vitro was very poor.Conclusion survivin antisense olignucleotides could sensitize human bladder transitional cell carcinoma T24 cells to TP40 with a cooperative effect.

    Key words: Transforming growth factor alpha; Antisense oligonucleotides; Bladder neoplasms; Therapy

    Bladder cancer is one of the most common tumors of the urinary system. 10% to 15% of non-invasive bladder cancer eventually develop into invasive bladder cancer or metastasis [1]. In recent years, biological treatment for the treatment of advanced bladder cancer provides a new way. Previous studies showed that recombinant transforming growth factor α  Pseudomonas aeruginosa exotoxin fusion protein (of TGFα  PE40 TP40) inhibited the growth of human bladder cancer [1]. The purpose of this study is to investigate the role of joint survivin antisense oligonucleotide and TP40 in human bladder cancer cell proliferation.

    1 Materials and methods

    1.1 Main material

    Human bladder cancer T24 cells (referred to as the T24 cells) and recombinant TP40 synthesized by the Shanghai Institute of Cell Biology, Chinese Academy of Sciences and offers. Full phosphorothioate survivin antisense oligonucleotides (AS), missense oligonucleotides (MS) and RT  PCR with primers by race Yum synthesis. AS sequence 5 ‘of  CCCAGCCTTCCAGCTCCTTG  3’ [2] MS sequence 5 ‘of  CCCACCCTTGCACCTCCTTG  3’.

    1.2 Methods

    1.2.1 Cell culture T24 cells were cultured in DMEM (Gibco) containing 15% fetal calf serum (Hangzhou Evergreen) 100ku / L of penicillin and streptomycin, and placed with 5% CO2, 37 ° C the incubator.

    1.2.2 cells transfected T24 cells Lipofectin (GIBICO / BRL Company) mediated transfection of the antisense oligonucleotide, operating according to the kit instructions. 6h after transfection with DMEM medium containing 15% fetal calf serum to terminate the reaction. The control group was treated with the serum-free DMEM medium containing the same concentration of Lipofectin.

    1.2.3 RNA extraction and RT  PCR

    Using TRIzol one-step extraction of total RNA. Taken 2μl total RNA, 70 ° C incubated for 10min. cDNA synthesis (reaction system 20μl): MgCl2 (25mM) 4μl, RT the buffer (× 10) 2μl dNTPs (10 mM) 2 μl RNA inhibitors (20u/μl) 0.5 μL of random primer (50mm) 1.0μl, AMV reversal transcriptase (25u/μl) 0.8μl. The reverse transcription conditions: 25 ° C incubated for 10min at 42 ° C incubated for 45min last 95 ℃ incubated 5min.

    PCR Amplification (reaction system 25μl): take 2μl RT product, plus 2.5μl PCR buffer (x 10), MgCl2 (25mM) 1.5μl dNTPs (10mM) 0.5 μL of Justice primer (25 mM) 0.5μl, antisense primer (25mM) 0.5μl 0.5 μL of Taq DNA polymerase (5u/μl). The sense primer design survivin 5 ‘ ATGGGTGCCCCGACG,  3’ antisense primer 5 ‘ ATCCATGGCAGCCAGCT  3’ (gene pool Find No. NM_001168). The reaction solution before 95 ℃ early degeneration 2min, then 30 cycles (survivin) PCR amplification, and final extension at 72 ℃ for 10min. Cycle parameters: 94 ° C denaturation 15s, 58 ° C annealing 30s, 72 ° C extends 30s. All specimens simultaneously GAPDH 25 cycles of PCR amplification as an internal control to measure the quality and quantity of RNA in each specimen. The PCR product was purified using a 2% agarose gel electrophoresis, ethidium bromide staining, UV imaging.

    1.2.4 Western blot detection collected T24 cells, lysis boil, centrifugation. The protein samples by 6% polyacrylamide gel electrophoresis after separation, is transferred to a nitrocellulose membrane, respectively, monoclonal antibody (1:2000) was incubated with mouse anti-human survivin (6E4). And then incubated with horseradish peroxidase conjugated anti-rabbit or anti-mouse antibody (1:5000). Finally, detected with enhanced chemiluminescence reagents.

    1.2.5 Flow cytometry fixed TP40 treatment with different concentrations of cells were collected, the PBS washed twice with 70% ethanol 4 ° C overnight. Washed twice with PBS, and then 800μl of propidium iodide and 200μl of DNase-free RNase A stain. Propidium iodide infected with the nucleus of the fluorescence intensity measured by flow cytometry.

    1.2.6 MTT assay living cells cells were seeded in 96-well plates at a density of 3 × 103 cells / well after 24 hours in each group were added to 100μl of serum-free DMEM formulated intervention treated with a solution of 1, 2, 3 days, including TP40 processing concentration of 750ng/ml [1], the oligonucleotide concentration was 300 nm, with untreated cells as a blank control (containing only Lipofectin serum-free DMEM medium). 6h after transfection replacement DMEM medium containing 15% fetal calf serum, while complementing the corresponding TP40. Detection added to each well of 25 μl of MTT (5 g / L), 37 ° C incubated for 2h each well 100 μl of Extraction buffer, 37 ° C and incubated overnight last with 96 empty plate microplate reader measured at 570nm absorbance value (A ) [3]. The cell viability was calculated by the following formula: A experimental group / A control group × 100%.

    1.2.7 vitro soft agarose tumors were collected from each group of cells in the logarithmic growth phase, with 0.25% trypsin digested into single cells, resuspended in 0.35% soft agarose DMEM at a density of 2 × 103/1.5ml (containing 10% fetal bovine serum) solution, then add 6-well plates has spread into the underlying glue. After 20 days of incubation, each well was added 1ml of 0.5mg/ml p  iodonitrotetrazolium villet (SIGMA) were incubated overnight to dry camera.

    1.3 statistical methods

    Using SAS version 8.2 statistical software for analysis of variance. P <0.05 was considered statistically significant.

    2 Results

    2.1 survivin antisense oligonucleotide T24 cells

    To different concentrations of survivin antisense oligonucleotide treatment for T24 cells 48h, found that survivin antisense oligonucleotide with increasing concentrations of survivin mRNA expression was significantly inhibited, but at concentrations above 300nM, its inhibition does not again significantly increased. Therefore, in the following experiments are used survivin antisense oligonucleotide concentration 300nM.

    2.2 the United suivivin antisense oligonucleotide and TP40 on T24 cells

    2.2.1 RT  PCR results survivin electrophoretic bands size 426bp GAPDH stripe size of 452 bp. As shown in Figure 1, GAPDH was used as an internal control visible AS group and TP40 T24 cells survivin fragment expression than the MS group and the control group was significantly weakened, and the combined group (AS + TP40) T24 cells survivin expression more reduced. No significant difference between the MS group and the control group.

    2.2.2 Western blot test results the survivin positive for performance as the molecular weight of 16kD bands. Β  actin as an internal control, as shown in Figure 1, we can see that the AS group and TP40 survivin expression in T24 cells than the MS group and the control group was significantly weakened the combination group (AS + TP40) T24 cells survivin expression is more reduced. No significant difference between the MS group and the control group.

    The 2.3 T24 cell proliferation biology characteristics

    2.3.1 MTT to detect the growth of cells in each group is shown in Figure 2, visible AS and TP40 significantly inhibited the growth of T24 cells, but the combination drug (AS + TP40) more pronounced growth inhibition (P <0.0001), the MS group than the control group had no significant difference (P> 0.05), AS group than in the TP40 group no significant difference (P> 0.05). Days 1, 2 and 3 of the combined group (AS + TP40) cell survival rates were 65.6%, 42.1% and 12.2%.

    2.3.2 Flow cytometry detection Figure 3 apoptosis of cells in each group. Visible MS group, only 9.52% of the 9.55% apoptosis, and the control group no significant difference. AS group, TP40 group were 36.96% and 57.15% of cell apoptosis, was 96.37% in the combination group (TP40 + AS) apoptosis, more obvious than medication alone group.

    2.3.3 vitro soft agarose into tumor test our ability to detect the cells in vitro anchorage-independent growth. Shown in Figure 4, in soft agar, T24 cells of the control group and the MS group shows strong growth, the formation of a large number of cloning. Contrast, TP40 group and AS group in vitro the ability of anchorage-independent growth is greatly reduced, and the combination group (TP40 + AS) cells were almost not form clones. In independent experiment was repeated for three times, the results have been good repetition.

    3 Discussion

    In recent years, the incidence of bladder cancer is significantly increased. The majority of bladder cancer infiltrative growth, recurrence is very common with topical therapy to control, but there are still 10% to 15% of non-invasive bladder cancer eventually develop into invasive bladder cancer or metastasis. Patients with advanced bladder cancer is the lack of effective treatment. Clinical proof of therapeutic effect of chemotherapy and radiotherapy is limited to the prevention of recurrence of bladder tumors, and the efficacy of the treatment of advanced bladder tumors. Numerous studies indicate that the gene therapy, and biological therapy is to control the most promising means of advanced tumors, and may be used for the prevention of tumor recurrence. Biological therapy and gene therapy research, anti-strength, the role of targeting and control that has been the pursuit of the goal of world researchers. Role completely controllable extremely difficult to achieve in the short term, most of the focus of current research focused on the role of targeting and increase the role of strength. This study investigated the biological treatment and anti-apoptotic means killing effect on bladder tumor cells.

    Tumor EGFR expression is considered to be an important symbol of the adverse differentiation, high levels of expression of EGFR can inhibit bladder tumor growth-oriented targets [4]. Numerous studies indicate that human bladder carcinoma express high levels of EGFR [5]. Using the means of genetic engineering to express a biological activity of TGFα  PE40 fusion protein (referred to as TP40) TGFa cDNA sequence with the cDNA sequence of PE40 (Pseudomonas exotoxin) fragment. This protein has the ability to bind with the target cell-specific expression of the EGFR, and thus plays the role of the guide, and carry both the PE40 to enter cells, efficient blocking of target cell protein synthesis and causes cell death. Previous studies have shown that the strong inhibition of TP40 T24 bladder cancer cell growth, able to significantly inhibit the T24 cell DNA synthesis, and induction of apoptosis in tumor cells, and this effect has oriented, EGFR overexpression of the tumor cells the obvious killing effect [1].

    In recent years, anti-apoptotic factor survivin may be involved in the mechanism of tumorigenesis [6], to take measures to cut survivin expression can inhibit tumor growth [7-9]. Studies have shown that survivin expression was significantly higher in bladder cancer, and survivin in normal tissue expression [10]. Further studies showed that the TP40 down to some extent the expression of survivin, survivin may be involved in the TP40 mechanism. This study for survivin antisense oligonucleotides were synthesized, and their combination using antisense oligonucleotides closed expression of survivin can enhance the growth inhibitory effects of TP40 T24 cells. Flow cytometry combined effects can significantly induce apoptosis in vitro soft agarose into tumor experiment also shows that the combined effects of cell anchorage-independent growth capacity poor. This, in turn, more proof Knockdown of survivin expression is the TP40 the role one of the mechanisms, and also found a stronger guiding new approaches to the treatment of bladder tumors, the joint application TP40 and survivin antisense oligonucleotide treatment of bladder tumors.

    In this study, further animal studies and clinical research laid the foundation, and opened up a new field for the clinical treatment of bladder cancer biological research.