Abstract Objective To construct the hTERT promoter fusion suicide gene CD: UPRT expression vector, research on human gastric cancer cell SGC7901 in vitro targeted killing effect. HTERT core promoter fragment was amplified by PCR, cloned into a luciferase reporter gene plasmid pGL3  Basic detection of hTERT promoter in human gastric cancer cells SGC7901 and human fibroblasts HLF transcription activity. Construction of the hTERT promoter CD: UPRT gene expression vector hTERT-CD: UPRT its regulation and CMV promoter CD: UPRT gene expression vector pcDNA3.1-CD: UPRT liposome transfection method were transfected into SGC7901 and HLF cells stably expressing cell lines, RT  PCR and Western blot to detect the expression of the CD gene was detected by MTT the 5  FC transfected cell killing effect. Results successfully cloned the hTERT core promoter; luciferase activity assay showed that the transcriptional activity of the hTERT promoter in SGC7901 cells positive controls (21.50 ± 2.15)%, only background activity in HLF cells. The successfully build hTERT promoter CD: UPRT gene expression vector, transfection of pcDNA3.1-CD: UPRT SGC7901 and HLF cells transfected with hTERT-CD: UPRT SGC7901 cells at the mRNA and protein levels could be detected in the CD gene expression and 5  FC sensitive; transfected hTERT-CD: the UPRT The HLF cell does not detect the expression of the CD gene, the the 5  FC does not sensitive. Conclusion The constructed hTERT promoter fusion suicide gene system CD: UPRT / 5-FC in vitro targeted killing SGC7901 cells.

Key words human telomerase reverse transcriptase promoter cytosine deaminase uracil phosphoribosyl transferase enzyme gastric cancer targeted gene therapy

    Suicide gene therapy is increasingly concerned about the people of [1]. CD: UPRT / 5  FC (cytosine deaminase: uracil phosphoribosyl transferase / 5  flucytosine, cytosine deaminsae: uracil phosphoribosyltransferase / 5  flurocytosine) suicide gene system is a highly effective, it suicide genes CD UPRT genes joint, constitute the fusion suicide gene significantly enhanced the antitumor effect. HTERT (human telomerase reverse transcriptase, hTERT) telomerase activity of the major determinants, in most of the tumor cells reactivate negative expression in most normal somatic cells [2], so hTERT promoter for gene therapy targeting. In this study, build the the hTERT promoter CD: UPRT / 5-FC suicide gene expression vector, to study its targeted killing effect on human gastric cancer cell line SGC7901.

    1 Materials and methods

    1.1 Materials

    1.1.1 cells and plasmid human gastric cancer cells SGC7901 and human cervical cancer cells HeLa saved Cancer Research Institute, Xiangya Medical College; HLF purchased from the Central Laboratory of Xiangya Medical College normal human fibroblasts. Luciferase reporter plasmid pGL3  Basic of pGL3  Control Promega Corporation, USA; plasmid pcDNA3.1-CD: UPRT built by the chamber.

    1.1.2 Main reagents LA Taq enzyme kit AMV reverse transcriptase kit, restriction endonucleases are Takara products, pGEM  T Easy vector Luciferase Assay kit, β  gal detection kit The are U.S. Promega Corporation, Lipofectamine2000 liposomes Invitrogen Corporation, USA products, primers for the synthesis of Shanghai Invitrogen Biotechnology Co., Ltd..

    1.2 Methods

    1.2.1 hTERT promoter PCR amplification and identification of P1: 5 ‘ GCGACGCGTGATTCGCGGGCACAGACG  3’, P2: 5 ‘ AAACTCGAGCCACGTGCGCAGCAGGAC  3’ Mlu Ⅰ, Xho Ⅰ restriction sites were introduced upstream and downstream primers () genomic DNA as template HeLa cells, hTERT promoter was amplified using Takara LA Taq enzyme, and cloned into pGEM  T Easy vector, pGEM  hTERT plasmid construct, Takara sequencing.

    PGEM  hTERT 1.2.2 of hTERT  pGL3Basic recombinant plasmid and identification will be built with Mlu Ⅰ and Xho Ⅰ double digestion, recovery of about 255bp hTERT promoter fragment cloned into pGL3  Basic, hTERT  pGL3Basic plasmid constructed with PCR and restriction enzyme digestion were identified.

    1.2.3 hTERT promoter transcriptional activity detection SGC7901, HLF cells inoculated 1 × 105 cells per well in 24-well plates and transfected cells reached 85% confluency. Each of these cells were transfected with three plasmids, namely the hTERT  pGL3Basic of pGL3  basic of pGL3  control plus β  gal as an internal control 48 hours after detection of luciferase activity with β  gal activity to the ratio of the two As a luciferase relative activity.

    1.2.4 of hTERT  CD: UPRT expression vector pGEM  hTERT Construction and identification with Mlu Ⅰ and Xho Ⅰ double digestion, recovery of about 255bp hTERT promoter fragment was cloned into the same Mlu Ⅰ and Xho Ⅰ double digested with pcDNA3.1-CD: UPRT (excision of the CMV promoter) to give the plasmid hTERT-CD: UPRT Both methods identified by PCR and digested.

    1.2.5 plasmid transfection and positive clones were screened with Lipofectamine2000 liposome the pcDNA3.1-CD: UPRT and hTERT-CD: UPRT respectively transfected SGC7901, of HLF cells, G418 screened the stably transfected cell lines, were named for SGC7901/pcDNA3.1  CD: UPRT SGC7901/hTERT-CD: UPRT-CD FOR HLF/pcDNA3.1: UPRT, HLF / hTERT-CD: UPRT.

    1.2.6 RT  PCR detection of CD gene expression of total cellular RNA was extracted AMV reverse reagents steps reverse transcriptase PCR amplified CD gene, are to spend the downstream primers were P1: 5 ‘ ATGGTGACAGGGGGAATG  3’, P2 : 5 ‘ TTGTGACCACGACCGAGA  3’.

    1.2.7 Western blot detecting the expression of the CD gene in total protein was extracted, electrophoretic separation of the 10% polyacrylamide gel, electrically transferred to a nitrocellulose membrane, room temperature closed 2H, 1:500 dilution of mouse anti-CD polyclonal antibody (QED company) 4 ° C overnight incubation, 1:1 000 dilution of rabbit anti-mouse secondary antibody (Sigma) was incubated at room temperature for 1h, color analysis.

    1.2.8 MTT France cell viability of the cells in each group of 5 × 103 cells / well were seeded in 96-well culture plate and incubated overnight Add to 5  FC, to a final concentration of 10μg/ml, 50μg/ml, respectively , 100μg/ml, 200μg/ml, 400μg/ml, mixed and incubated 4d, cell viability was detected by MTT.

    1.3 Statistical Methods SPSS12.0 statistical software for the t-test and analysis of variance.

    2 Results

    2.1 hTERT promoter PCR amplification and identification of PCR amplification of DNA fragments of about 267bp, as shown in Figure 1, consistent with the expected results; the pGEM hTERT carrier sequencing results showed that the cloned the hTERT sequence with GenBank (serial number: AB016767) the hTERT sequence of exactly the same.

    2.2 hTERT  pGL3Basic recombinant plasmid construct and identification

    Build hTERT  pGL3Basic amplified by PCR and hTERT, about 267bp fragment, consistent with the expected results; Mlu Ⅰ and Xho Ⅰ restriction enzyme digestion, DNA fragments of about 255bp and 4.8kb size, consistent with the expected results, as shown in Figure 1.

    2.3 hTERT promoter transcriptional activity detection

    Positive control (100%), pGL3  Control of hTERT relative transcriptional activity in various cells are shown in Table 1, only the background of the transcriptional activity of the hTERT promoter in HLF cells, SGC7901 cells display a higher transcriptional activity as positive controls (21.50 ± 2.15)%. Table 1 hTERT promoter transcriptional activity BasicSGC7901100% (21.50 ± 2.15)% (0.51 ± 0.07)% HLF100% (0.40 ± 0.07)% (0.34 ± 0.04)%

    2.4 hTERT  CD: UPRT expression vectors and their identification

    Build hTERT-CD: UPRT amplified by PCR hTERT, about 267bp fragment, consistent with the expected results; Mlu Ⅰ and Xho Ⅰ double digestion, approximately 255bp fragment and 6.4 kb in size, with the expected results consistent, Figure 2.

    2.5 RT  PCR to detect the expression of the CD gene

    The results show SGC7901/pcDNA3.1  CD: UPRT, SGC7901/hTERT  CD: UPRT, HLF/pcDNA3.1  CD: UPRT group amplified a CD gene product of approximately 152bp, HLF / hTERT  CD: UPRT and negative control There were no CD gene expression, as shown in Figure 3.

    2.6 Western blot to detect the expression of the CD gene

    The results show the SGC7901/pcDNA3.1  CD: UPRT SGC7901/hTERT-CD: UPRT HLF/pcDNA3.1  CD: UPRT group relative molecular weight of about 4.2kD the CD: UPRT fusion protein expression, HLF / of hTERT  CD: UPRT and negative control group CD: UPRT expression, as shown in Figure 4.

    1: SGC7901/pcDNA3.1  CD: UPRT; 2: SGC7901/hTERT  CD: UPRT; 3: SGC7901; 4: HLF/pcDNA3.1  CD: UPRT; 5: HLF / hTERT  CD: UPRT; 6: HLF

    Figure 4 Western blot detection CD: UPRT expression

    2.7 MTT assay of cell viability

    The of 5  FC on transfected with hTERT-CD: UPRT SGC7901 cell killing effect, 5  FC 400μg/ml cell survival rate of only 10.21% of transfected hTERT-CD: UPRT HLF cell destruction role; 5  FC transfected pcDNA3.1-CD: UPRT SGC7901 and HLF cells showed significant killing effect, as shown in Figure 5.

    Figure 5 different concentrations of of 5  FC destruction of cells in each group

    3 Discussion

    The reason why the suicide gene therapy gained much attention, one of the reasons is the bystander effect. Bystander effect making transgenic cells were killed while around a large number of non-genetically modified cells were also killed [3,4], which would address a major obstacle in gene therapy, gene transfer efficiency.

    CD: UPRT / 5  FC suicide gene system CD enzyme (cytosine deaminsae, cytosine deaminase) the 5  FC nontoxic into toxic 5-Fu  Fu in the body through a series of enzymatic reactions converted into 5  FUMP (5  fluorouridine monophosphate), further the formation FUTP and FdUMP, thereby interfering RNA and DNA synthesis, to play the anti-tumor effect. UPRT is a pyrimidine remedy enzymes from bacteria and other microorganisms, direct catalytic 5  Fu 5  FUMP reduce a variety of competitive enzyme degradation of 5  Fu, and improve the efficacy of 5  Fu [5,6] . Chung  Faye [7] found that the the transfection CD: UPRT gene and colon cancer cells transfected with the CD gene compared to the former the 5  FC’s sensitivity is 100 times that of the latter, and shows more spectator effect.

    Targeting is one of the key issues in gene therapy. In most normal somatic cells, telomerase expression is negative [8], and in about 85% of human malignancies telomerase activation [9]. hTERT is the catalytic subunit of telomerase is the major determinant of telomerase activity. HTERT in cells in the expression of the telomerase activity of the rate-limiting step in the the telomerase activation process, [2]. hTERT expression regulation occurs mainly at the transcriptional level, approximately 181bp upstream of the transcription initiation sites proximal to the core promoter region, necessary for hTERT transcriptional activation [10]. The hTERT promoter is useful for tumor targeting gene therapy.

    In the present study, we amplified the hTERT gene upstream of the ATG 249bp of the promoter sequences of between 120 to 369, and contains the above-described core promoter region. Promoter activity by luciferase reporter gene system analysis, the results showed that hTERT promoter activity in telomerase-positive SGC7901 cells was significantly higher for the positive control pGL3  control (21.50 ± 2.15)%, while in telomerase negative HLF cells only the background active, confirmed that hTERT promoter downstream gene-specific expression in telomerase-positive cells.

    Further studies have shown that the transfected CMV promoter control pcDNA3.1-CD: UPRT after SGC7901 and HLF cells have the CD gene’s expression, 5  FC sensitive, indicating that the CMV promoter does not have a tumor-specific; whereas in transfected hTERT-CD: UPRT after the SGC7901 cells only detected in the expression of the CD gene, and the 5  FC sensitive, there is no CD in the HLF cell gene expression, of 5  FC nor sensitive, indicating that tumor-specific hTERT promoter regulates the CD: the specific expression of the the UPRT gene in telomerase-positive tumor cells, and its activity is strong, with CMV promoter control CD: UPRT activity roughly SGC7901 cells.

    Targeted gene therapy to hTERT promoter fears its expression in vivo telomerase-positive normal cells, such as germ cells, hematopoietic stem cells, activated lymphocytes toxicity. Gu et al [11] constructed the bax gene adenovirus expression vector under the control of hTERT promoter, and mice in a six-month observation, found no significant abnormal hematopoietic system and the liver of mice, at the same time they also found that the normal human bone marrow CD34 + hematopoietic progenitor cells, hTERT promoter activity is very low, close to the background level, so that limited the potential stem cell-related toxicity. Kuppuswamy et al [12] study also confirmed hTERT related toxicity.

    Therefore, we believe that the human telomerase reverse transcriptase promoter regulated fusion suicide gene system CD: UPRT / 5-FC can target killing cancer cells, provides another option for the treatment of gastric cancer.