• 【Abstract】 Objective To investigate the the hepatoma 14  3  3σ gene promoter hypermethylation and its relationship with the level of transcription. Methods 14  3  3σ promoter methylation using methylation-specific PCR detection; 14  3  3σ mRNA expression levels by real-time quantitative PCR. 14  3  3σ promoter methylation in liver cancer patients with paraneoplastic tissue, cirrhosis of the liver tissue and cancer tissue positive rates were 6.8% (3/44), 56.1% (23/44) and 93.2% (41 / 44). 0.05);发生甲基化的组织标本中90.6%(58/64) 转录缺失,">Different gender, degree of differentiation and the organization of the hepatitis B virus status 14  3  3σ methylation frequency no significant difference (P> 0.05); occurred methylation of tissue specimens, 90.6% (58/64) transcription missing 10.4% transcription levels without methylation occurred specimens 14  3  3σ mRNA expression levels were basically normal. 14  3  3σ methylation and mRNA levels were significantly negatively correlated (P <0.05). 14  3  3σ methylation and its mRNA expression levels are closely related (P <0.05). Conclusion from paracancerous organizations, cirrhotic liver tissue to cancerous tissue, 14  3  3σ gene promoter methylation frequency gradually increased, and its mRNA expression correlated prompted 14  3  3σ promoter methylation may be formed in HCC is an early event in the course of a certain relationship with HCC.

    Key words liver cancer; 14  3  3σ; promoter; methylation; expression

     Detection of Promoter Hypermethylation and mRNA Expression of 14  3  3σ Gene in Tissues of Human Hepatocellular Carcinoma

        LI Hai  ping, ZHANG Ji  cai, FENG Jing, YU Zong  tao, LV Jun

        Taihe Hospital Affiliated of Yunyang Medical College, Shiyan 442000, China

        Corresponding Author: ZHANG Ji  cai, E  mail: adamzhang418@yahoo.com Abstract: Objective To investigate promoter methylation status, mRNA expression of 14  3  3σ gene and their relationship in hepatocellular carcinoma (HCC). Methods The methylation status of the 14  3  3σ gene in tissues were detected with methylation  specific PCR.The 14  3  3σ mRNA expression was examined by real  time PCR.Results Hypermethylation of CpG islands of the 14  3  3σ gene was detected in 93.2 % (41/44) of the HCC tissues, 56.1% (23/41) of cirrhotic tissues and 6.8% (3/41) of cancer  adjacent tissues, no significant difference between different clinical pathological features, such as gendre, differentiation and HBV infection status. mRNA expression of 14  3  3σ in tissues without methylated product approximated to the normal level, whereas, that in 58/64 (90.6%) of samples with methylated product were lower than the detection limit, 10.4% were lower than the normal level. The expression and methylation of 14  3  3σ were negatively correlated (P <0.05). Conclusion These results indicate that hypermethylation plays a causal role in inactivation of the 14  3  3σ gene in HCC. Hypermethylation and the resulting loss of expression of the 14  3  3σ gene corresponds to one of the most common abnormalities reported to date in HCC, suggesting their crucial role in the development of HCC.

        Key words: Hepatocellular carcinoma; 14  3  3σ; Promoter; Methylation; Expression

    14  3  3σ tumor suppressor gene located at 1p35, is responsible for the regulation of the G2 cell cycle checkpoint, plays an important role in the repair of DNA damage. Significantly down-regulated protein expression in primary bladder cancer, colon cancer and breast cancer. With the deepening of the performance of genetic research, gene promoter methylation was found 14  3  3σ gene expression inactivation of one of the main mechanisms, but rarely reported in HCC. In this study, using methylation-specific PCR (methylation  specific PCR, MSP) detection of HCC tissues 14  3  3σ gene methylation status of the promoter region, using SYBR green I real-time quantitative PCR 14  3  3σ mRNA transcriptional level in liver cancer, and to explore the role of 14  3  3σ gene methylation his transcription of the relationship, as well as 14  3  3σ gene promoter methylation in HCC formation process.

        1 Materials and Methods

        1.1 Data

        1.1.1 Source 44 cases of liver cancer patients from Yunyang Medical College Affiliated Taihe Hospital from March 2002 to December 2005 hospitalized patients, male 35 cases, 9 females, average age 50 years (range 37 to 67 years old) diagnosis confirmed by pathology. Postoperative take the cancer tissue, cirrhosis of the liver tissue and cancer tissue.

        1.1.2 Main reagents and instruments Wizard DNA clean up kit, Reverse Transcription System A3500, the Trizol Reagent (Promega); PCR reagents (SABC); SYBR Green I (Gene Company); hydroquinone and sodium bisulfite (Sigma Company). PE7000 (ABI, USA), DU640 spectrophotometer (Beckman, Germany).

        1.1.3 Primers were synthesized by Takara. 14  3  3σ methylation primers [1] (5 ‘ TGGTAGTTTTTATGAAAGGCGTC  3’, 5 ‘ CCTCTAACCGCCCACCACGG  3’); product for bp in length; 14  3  3σ unmethylated primers [1] (5 ‘ ATGGTAGTTTTTATGAAAGGTGTT  3, 5’  CCCTCTAACCACCCACCACA  3 ‘); 14  3  3σ mRNA in cited material [1] (5’  GTGTGTCCCCAGAGCCATGG  3 ‘, 5’  ACCTTCTCCCGGTACTCACG  3 ‘); parameters than gene GAPDH mRNA cited material [ 1] (5 ‘ TCATTGACCTCAACTACATGGTTT  3’, 5 ‘ GAAGATGGTGATGGGATTTC  3’).

        1.2 Methods

        1.2.1 Tissue DNA extraction DNA was extracted to the classic phenol  chloroform extraction method UV 260 nm quantitative after  80 ℃ save spare.

        1.2.2 tissue RNA was extracted using Trizol extracted RNA, and operate according to the instructions. After extraction and dissolved in double-distilled water free of RNA enzymes now reversed into cDNA.

        A3500 kit 1.2.3 cDNA synthesis applications, operating according to the instructions. About as follows: take 2 μl (approximately 1μg) Total RNA was extracted PCR amplification tube the amplified PCR thermal cycler 70 ℃ for 10 min, immediately placed on ice, then add the following ingredients: 25 mmol / L magnesium chloride μl, reverse transcriptase 10 times buffer, 2 μl of 10 mmol / L dNTP mixture 2μl Recombinant RNasin Ribonuclease Inhibitor 0.5 μl AMV reverse transcriptase 15 u Oligo (dT) 15 Primer 0.5 μg plus nuclease-free double-distilled water. to 20 μl. Centrifuged at 20 s set PCR instrument, 42 ° C for 15 min, 95 ° C for 5 min standby immediately placed on ice.

        1.2.4 SYBR Green Ⅰ real-time quantitative RT  PCR using RNA enzyme double distilled water diluted cDNA to 100 μl PCR reaction system is as follows: Add diluted cDNA solution 5 μl, 2 mmol / L dNTP mixture, 3 μl 25 mmol / L magnesium chloride 3 μl 10 × buffer, 3 μL, upstream and downstream primers (50 pmol / L) 2μl, Taq DNA polymerase 2u, 20 times the SYBR Green I 0.75 μl, plus nuclease-free double-distilled water to 30 μl. Amplification: (95 ° C for 60 s, 58 ° C for 30 s at 72 ° C for 60s, 83 ° C for 10 s), 40 cycles, to read fluorescence value at 83 ℃.

        1.2.5 14  3  3σ gene relative quantification method using detected by the CT value and the calculated obtained amplification efficiency, GAPDH mRNA as a reference to calculate the relative amount of 14  3  3σ mRNA. 14  3  3σ mRNA / GAPDH mRNA = (1 + EGAPDH) Ct (GAPDH) / (1 + E14  3  3σ) Ct (14  3  3σ) [2].

        1.2.6 Genomic DNA modification according to the literature [3]. 4 μg (adjusted to 50 μl) genomic DNA was added to a final concentration of 50 μl of 0.3 mol / L NaOH alkaline solution, 37 ° C incubation, 15 min denaturation; temporary preparation of 3 mol / L sodium bisulfite ( pH 5.0) 520 μl with 10 mmol / L of the hydroquinone 30 μl gently mixed, and then added 0.2 ml of mineral oil, 55 ° C incubator at 16 h; desalted through nucleotide modified DNA with Wizard DNA Clean  Up System purification recovery, 50 μl deionized water elution; adding 3 mol / L NaOH 5.5 μl of 37 ° C water bath 30 min the reaction was terminated by adding 55 μl 10 mol / L ammonium acetate and 2 μl glycogen (5 mg / ml) and 2.5 times the volume of precooled ethanol precipitation. The centrifugal drying after re-dissolved in 50 μl deionized water, set -40 ℃ standby.

        The 1.2.7 MSP volume of 30 μl reaction mixture containing 10 × PCR buffer, 3 μl of Mg2 +2.5 mM dNTPs 250μM each primer 0.22 μm of each take the 1.2.6 modified DNA samples 4 μl (approximately 50 μg), TaqDNA polymerase (Japan Takara Company) 2.0 U. PE7000 on amplification: 95 ° C denaturation for 5 min, 95 ° C denaturation for 1 min, 58 ° C annealing 1 min, an extension at 72 ° C for 1 min, 38 cycles of extension at last one cycle 70 ° C for 5 min. MSP product with a sample buffer 5:1 mixture after electrophoresis on a 2.5% agarose gel after ethidium bromide staining in ultraviolet detection, photography. Human placental tissue DNA methylase Sss I transformed as methylation positive control, healthy human lymphocyte the methylation DNA as a negative control.

        1.2.8 statistical methods using the SPSS12.0 software analysis, mRNA quantitative measurement with chi-square test, t test promoter methylation status does not meet the χ2 test using Fisher’s exact test. P <0.05 was considered statistically significant.

        2 Results

        2.1 HCC tissues 14  3  3σ gene promoter methylation status

        The organization next hepatocellular carcinoma in patients with cancer, cirrhosis of the liver tissue and cancer tissue in 14  3  3σ promoter methylation positive rate were 6.8% (3/44), 56.1% (23/44) and 93.2% (41/44) . The positive results shown in Figure 1. 0.05)。">Different gender, HBV infection status, grading HCC patients positive rate of 14  3  3σ gene methylation are shown in Table 1, the difference was not significant statistically significant (P> 0.05).

        2.2 14  3  3σ relationship between gene promoter methylation and 14  3  3σ gene transcription Table 1 14  3  3σ gene methylation status and liver cancer and pathological features with real-time quantitative PCR detection of 14  3  3σ mRNA expression levels, the results shown in Figure 2.41 cases methylation in cancer tissues of 40 cases presented 14  3  3σ mRNA transcription deletions (38 PCR cycles were not detected), 1 cases lower expression levels; 23 18 cases of 14  3  3σ mRNA expression missing patients had cirrhosis of the liver tissue methylation, reduce the level of expression of five cases; the three cases methylation paracancerous expression levels of the organization to reduce. In total, 90.6% (58/64) of the tissue methylation occurs transcription missing 9.4% decline normal specimens without methylation in the expression level of the basic. 14  3  3σ methylation and mRNA levels were significantly negatively correlated (P <0.05).

        3 Discussion

        DNA methylation mediated by methylase some nucleotides in the DNA, to increase the one methyl chemical modification process. DNA methylation in tumor cells mainly in two forms: hypermethylation of the promoter region (promoter hypermethylation) and overall genome methylation reduce the level of (global hypomethylaiton). Genome reduces the overall level of methylation can lead to the decrease in stability of the genome, and oncogene activation; methylation in the promoter region is one of the important reasons for inactivation of tumor suppressor gene expression.

        G1 / S and G2 / checkpoint two cell cycle control point in the cell cancerous process is governed by a variety of tumor suppressor gene regulation. In a previous study, we found that the regulation of G1 / S checkpoint of the tumor suppressor gene p16 methylation abnormalities involved in the process of the formation of HCC related to HBV infection [4]. 14  3  3σ regulation by the role of p53 and G2 / M checkpoint, high expression in normal epithelial tissues through the phosphorylation while of cyclin CDKS complex involved in cell cycle regulation, inhibition of the cells into the proliferation cycle and prevent split , promote terminal differentiation, induction of apoptosis, is considered an important cell cycle negative regulator. The current study found that 14  3  3σ in breast cancer have a higher frequency of methylation [5  8], methylation changes in breast cancer growth and the very close relationship. Ferguson et al [1] found 48 cases of breast cancer, 45 cases presented 14  3  3σ mRNA transcription down, and 14  3  3σ gene aberrant methylation. Our previous study also shows that the 14  3  3σ in breast cancer transcriptional expression of its gene promoter methylation is closely related to [9].

        The role of methylation in liver cancer is not yet clear. We use the the the MSP assay hepatocellular carcinoma in patients with paraneoplastic organization, 14  3  3σ gene methylation status of hardened tissue and cancer tissue. The presence of a high frequency of methylation found in cancer tissue of liver cancer patients, is consistent with the foreign reports [10]. In addition, we still hepatoma patients with cirrhosis of the liver tissue and paraneoplastic tissues detected 14  3  3σ methylated products, and from the adjacent tissues, cirrhotic liver tissue to cancerous tissue presents positive rate gradually increased trend. Due to cirrhosis of the liver is the early stage of liver cancer formation, suggesting that the 14  3  3σ methylation of liver cancer may be formed one of the early events involved in liver cancer formation process. 14  3  3σ methylation frequency of different gender, tumor differentiation of HCC tissues no significant differences further illustrate this point. Regulation of the G1 / S checkpoint gene p16 is not found in the test 14  3  3σ methylation HBV infection, unexplained might The HBV promote some selective methylation.

        Gene promoter methylation is an important reason for the expression of tumor suppressor gene inactivation or silent. SYBR green I is a double-stranded DNA minor groove binding fluorescent dye, no probe design, the experimental low degree of difficulty, is a simple and practical quantitative PCR technology. SYBR green I real-time quantitative PCR 14  3  3σ mRNA transcription level. Found that 90.6% of the organizations 14  3  3σ methylation failed to detect the mRNA expression level of 10.4% decreased expression. 14  3  3σ promoter methylation in liver cancer is one of the important reasons mRNA expression levels.

        In short, by the detection of liver cancer organizations in 14  3  3σ gene promoter methylation and its expression. Found that liver cancer formation process 14  3  3σ gene promoter methylation frequency was gradually increasing trend, and its promoter methylation and its mRNA level is closely related. These 14  3  3σ promoter methylation is one of the early events play a role in the incidence of liver cancer, liver cancer formation process.