Key words survive prime oligonucleotide antisense bladder cancer apoptosis

    Survivin (survivin) gene in the tumor-specific expressed genes to express specific column 4 [1]. Research in bladder cancer diagnosis, treatment and determine prognosis deepening [2]. We apply survivin antisense oligonucleotide and the liposome form an effective composite observed induced bladder cancer cell line T24 apoptotic mechanism. The report is as follows.

    1 Materials and methods

    1.1 cell line

    Routine culture of human bladder cancer cell line T24.

    (ODNS)  liposomes (Lip) 1.2 oligonucleotide transfection complexes

    Phosphorothioate modified oligonucleotide sequences are as follows: the antisense sequence: 5 ‘ CCCAGCCTTCCAGCTCCTTG  3’; sense sequence: 5 ‘ CAAGGAGCTGGAAGGCTGGG  3’, are drawn from the Gene Bank. The liposomes lipofectamine2000, by transfection kit described the configuration different concentrations of ODNs  Lip composite.

    1.3 Western blot blot test

    48 h transfection, cells were collected, of Triton reagents total protein was extracted, the UV spectrophotometer measuring the protein content. Adjusted to a protein concentration of 2 g / L, take 10 μl sample plus 20 μl of sample handling liquid heating at 95 ° C water bath for 4 min, cooled to room temperature. Polyacrylamide gel in SDS  plus samples of 15 μl, indicator to electrophoresis tank is taken out of the edge of the edge of the offset, transblot system, the protein samples were transferred to nitrocellulose membrane. Closed protein dry powder 1 g plus 0.02 mol / L PBST 100 ml, 37 ℃ closed for 1.5 h. With 0.02 mol / L PBST washing nitrocellulose membrane. DAB staining, photographic. Repeat 8 times.

    1.4 MTT test

    T24 cells starting at a concentration of 1 × 104 / well. The antisense ODNs  Lip Complex 100, 200, 400, nmol / L for the transfection group; justice ODNS  Lip Complex 400 nmol / L and blank as a control group. For 24h, 48h and 72h after the absorbance at 570 nm wavelength detection ELISA analyzer.

    1.5 changes in apoptosis by flow cytometry

    Take the logarithmic phase of T24 cells, the concentration of 2 × 105 / ml. 400 nmol / L the antisense ODNs  Lip complexes were transfected with the control group applications RPMI  1640 culture medium. Flow cytometry at 24 h, 48 h and 72 h for the detection of apoptosis.

    1.6 statistical methods

    Western blot image gray value using Image Tool software analysis, the application of single-factor analysis of variance and q test, P <0.05 was considered statistically significant.

    2 Results

    2.1 Western blot blot test

    The antisense compound handle T24 cells 48 h, as the concentration increased survivin protein expression levels, and justice group and control group difference was statistically significant (P <0.01). Table 1. Table 1 Western blot blot test results (± s)

    2.2 MTT assay cell inhibition rate

    The antisense compound T24 cells after treatment with increasing concentration and time, the cell growth inhibition rate gradually increased, and justice group and control group difference was statistically significant (P <0.01). Table 2.

    2.3 cell apoptosis was detected by flow cytometry

    T24 cells by role, flow cytometry typical hypodiploid peak and the hypodiploid peak peak with increase treatment time and justice group and control group difference was statistically significant (P <0.01). Table 3. Table 3 400 nmol / L antisense oligonucleotide different time rate of apoptosis

    3 Discussion

    survivin malignant potential value of diagnostic markers and prognostic factors of its existence indicates that the tumor is poorly differentiated, high clinical stage, decline in 5-year survival rate and overall survival, disease-free survival time, recurrence rate increased [3 , 4]. survivin tumor-specific apoptosis inhibitory protein expression levels in adults in most tumor tissue abnormally elevated [5]. Can be taken to suppress its expression or interfere with its role in the strategy to treat tumors, molecular targeted therapy alone or in combination with other anti-cancer treatment, inhibits in vitro tumor formation and the formation of tumor growth [6].

    The present study the Western blot blot tests showed that the the survivin antisense compound down T24 cells survivin protein expression, the expression level decreased with the increase in the concentration of the antisense compound. Prompted liposomal antisense transfection is successful, the survivin antisense compound can be significantly lowered T24 cells survivin protein expression, and render a concentration-dependent. MTT assay showed that apoptosis of T24 cells with treatment time and an increasing trend. Flow cytometry T24 cells were treated the antisense surivin complex treatment typical apoptotic hypodiploid peak, the hypodiploid peak peak with increase treatment time. The hypodiploid peaks appear and increase quantify bladder cancer cell apoptosis objective indicators liposomal transfection of survivin antisense oligonucleotide can induce bladder cancer cell apoptosis, and apoptosis rate certain time-dependent.

    The study showed that of survivin molecular targeted therapy can induce tumor cell apoptosis and inhibit tumor angiogenesis dual mechanism to play the anti-tumor effect [7]. High apoptotic index patients 5-year survival rate was significantly higher than the low apoptotic index group, induce tumor cell apoptosis is an effective anti-tumor therapy [8]. Our data show that liposomal transfection of survivin antisense oligonucleotide can be induced in vitro cultured human T24 bladder cancer cell apoptosis may provide a new approach for the comprehensive treatment of bladder cancer.