Abstract Objective eukaryotic expression plasmid pmU6 based, built for bi  1 gene expression in cells, short hairpin RNA (shRNA) plasmid vector, and observe the CNE  2Z, CNE  1, HO8910PM, HO8910 cell line growth and proliferation. The synthetic bi  1 oligonucleotide chain, annealing cloned into pmU6 vector to generate recombinant plasmid, recombinant plasmid transfected into cells, was observed by MTT colorimetric transfection reagent and plasmid vectors on cell growth and proliferation . The results compared with the untreated group, bi  1shRNA CNE  2Z CNE  1, HO8910PM the growth and proliferation of the cell lines significantly inhibited the growth and proliferation of HO8910 cell lines no significant inhibition. Conclusion The recombinant plasmid expression in cells shRNA, to produce RNA interference (RNA interference, RNAi) effect and specifically inhibit the growth and proliferation of the target cells, gene therapy for nasopharyngeal carcinoma and ovarian cancer for plasmid-mediated RNAi technology to provide a certain theoretical basis.

Key words RNAi gene transfection bi  1

    RNAi refers to the organism’s cells, the exogenous or endogenous double-stranded RNA (double  stranded RNA, dsRNA) starts and mediated its homologous mRNA specific degradation, thereby inhibiting the process of the corresponding gene expression in [1] . In the RNAi process, intracellular small interfering RNA (small interfering RNA, siRNA) sources have different forms, the siRNA expression vector (plasmid or viral vector) method is most widely used. Eukaryotic expression plasmid pmU6 designed and constructed shRNA expression plasmid for bi  1 gene five different sites to siRNA expression in tumor cells, and to observe bi  1shRNA expression plasmid in both tumor cells mediated RNAi effect on the growth and proliferation of target cells.

    1 Materials and methods

    1.1 strains, cell lines and plasmids

    E. coli DH5α since the introduction of the Ministry of Health, Wuhan Institute of Biological Products; nasopharyngeal poorly differentiated epithelial cell line CNE  2Z, well-differentiated nasopharyngeal epithelial cell line CNE  1, highly metastatic ovarian serous adenocarcinoma cell line HO8910PM cell lines ovarian serous adenocarcinoma cell line HO8910 introduced from Shanghai celled organisms; pmU6 plasmid by our group to build and save [2].

    1.2 Reagents and instruments

    RPMI  1640 medium and fetal calf serum was purchased from Gibco, USA; liposomes (Lipofectmine TM2000) were purchased from Invitrogen Corporation; plasmid DNA miniprep kit was purchased from Takara Biotechnology Co., Ltd.; tools enzymes were purchased from New England Biolabs Inc. (NEB) and the Sino-American Biotechnology Company; tetrazolium blue (MTT) was purchased from Sino  American Biotechnology Company; microplate reader products for Bio  Rad; Other reagents are imported or domestic analytically pure product.

    The 1.3 express carrier bi  1shRNA Construction and Identification

    SiRNA sequence design according to the principles of Reynolds et al [3], from the people bi  1 gene (gi: 23271 944) sequence, select the Position: 212 to 238 Position: 350 to 376, the Position: 573 ~~ 599 Position: 735 to 761 four sites (bi  1 CDS 141 to 854), were named as bi  1  1, bi  1  2 bi  1  3  bi  4, the corresponding recombinant plasmid named pmU6  bi  1  1, pmU6  bi  1  2, pmU6  bi  1  3, pmU6  bi  1  4; design a negative control siRNA sequence, named bi  1  s The recombinant plasmid named pmU6  bi  1  s. Candidate bi  1 siRNA sequence through the GenBank database BLAST analysis. the siRNA sequence listed only positive-strand sequence: bi   1 (27nt) sense strand: 5 ‘ GCAGCACCTGAAGAAGGTCTATGCAAG  3’; bi  1  2 (27nt) sense strand: 5 ‘ GCTGATGGCAACACCTCATAGCCATGA  3’; bi   3 (27nt) sense strand: 5 ‘ GGTATCTTGATGTCAGCCCTGAGCTTG  3’; bi  1  4 (27nt) sense strand: 5 ‘ GGAGATCAAGATTATATCTGGCACTGC  3’; bi  1  s (27nt) sense strand: 5 ‘ GGTATCTTGATGTGCCACCTGAGCTTG  3 ‘. Expression of shRNA transcription template by 9bp connection fragment of the sense strand of the siRNA sequence (27nt) and antisense strand (27nt) connected inverted repeats, five pairs of shRNA transcription template sequence by Shanghai Sangon technical services Limited synthesis.

    Bbs Ⅰ digested pmU6 large fragment each shRNA transcription template annealing directed reorganization, then transformed positive clones were screened. Miniprep plasmid DNA of positive colonies directly on 1% agarose gel electrophoresis; another 1μg of plasmid DNA from each PCR amplification pmU6 upstream primer: 5 ‘ CGACACGGAAATGTTGAA  3’; pmU6 downstream primer: 5 ‘ AGGGAAGAAAGCGAAAGGA  3 ‘. PCR amplification parameters at 94 ° C for 3min at 94 ° C for 40s, 52 ℃ 90s, 72 ℃ 1min, 30 cycles of 72 ℃ for 7min. 2% agarose gel electrophoresis of PCR amplification products, sequencing will be carried out by agarose gel electrophoresis, the preliminary identification of the correct positive colonies.

    1.4 Cell culture and transfection

    Routine passage CNE  2Z, CNE  1, HO8910PM, HO8910 cell lines were cultured in RPMI  1640 culture medium, taking the logarithmic growth phase cells used in the experiment, in accordance with the operating manual of the transfection reagent transfection experiments [4].

    1.5 MTT colorimetric detection rate of cell growth inhibition

    The untreated group experimental design, Lip (liposomes) group, pmU6 plasmid control group, the reorganization of interference plasmid group. Each group of the plasmid concentration of 2mg / L (0.2μg / hole); the LIP group corresponding concentrations transfected plasmid required amount designed final concentration. 48h after transfection, each well was added to 10g / L MTT 10μl, culture 4h, add dimethylsulfoxide 100μl, measuring the absorbance at A value of wavelength 570nm and 630nm. In each of four parallel holes, and the results are averaged, the experiment was repeated three times. The cell growth inhibition rate by the following formula: Inhibition rate (%) = (1 – Experimental hole A value / the control wells A value) × 100%.

    1.6 statistical methods

    Experimental data to ± s statistical software SPSS13.0 for Windows, single-factor analysis of variance and significant difference test. 0.05为差异无统计学意义,P<0.05为差异有统计学意义,P<0.01为差异有显著统计学意义。">P> 0.05 for the difference was not statistically significant, P <0.05 was considered statistically significant, P <0.01 was considered significant statistically significant.

    2 Results

    2.1 expression bi  1 shRNA recombinant plasmids identified

    The extracted plasmid subjected to 1% of agarose gel electrophoresis, the results shown in Figure 1. Electrophoresis results theoretical value (plasmid pmU6 for the 4 856bp, plasmid pmU6  bi  1  1 pmU6  bi  1  2, pmU6  bi  1  3 pmU6  bi  1  4 and pmU6  bi  1 4 614bp)  s are consistent. 2% agarose gel electrophoresis of PCR amplification products, and the results shown in Figure 2. The PCR amplification product of each of the recombinant plasmids as 752bp, plasmid pmU6 the PCR amplification product of 994bp, the results of electrophoresis with the theoretical value.

    2.2 recombinant plasmid expression bi  1 shRNA CNE  2Z, CNE  1, HO8910PM HO8910 cells growth and proliferation impact

    In order to observe for bi  siRNA sequence design the CNE  2Z, CNE  1, HO8910PM strain HO8910 cells inhibition efficiency of CNE  2Z, CNE  1, HO8910PM, HO8910 cell strains transfected with the recombinant plasmid experiments, MTT results are shown in Table 1 to 4. Table 1 liposome-mediated recombinant plasmid CNE  2Z cell growth inhibition

3 Discussion

    RNAi is mediated by dsRNA homologous mRNA specific degradation phenomenon. RNAi as a new means of reverse genetics caused widespread concern first successful since 2001 Tuschl RNAi technology for mammalian cells since [5], the RNAi not only be applied to the mammalian cell gene function The analysis has also been widely used in cancer gene therapy.

    As selected by the target gene bi-1 is found in recent years, an apoptosis inhibitor, does not belong to any related gene family of programmed cell death (programmed cell death, PCD) is a few at the same time present in animals and plants conserved cell death in one of the inhibitors; animals bi  1 by bcl  new regulatory factor 2 and bax regulation of cell death pathways. Compared with the corresponding normal cells, bi  1 in prostate cancer [6], primary breast cancer [7, 8] cells increased from 4 to 10 times; Further, uterine cancer, ovarian cancer and lung adenocarcinoma cancer cells [9] also found that upregulation of bi  1 gene expression and these bi  1 gene overexpression may be associated with a variety of tumor development is closely related. The use of RNAi technology repressor bi  1 gene in human prostate cancer, the expression in primary breast cancer, has been satisfied with the results of the induction of tumor cell apoptosis, so bi  1 is expected to become a potential prognostic marker for these tumors. Reported in the literature [8], BI-1 expression in some tumor cells is not dependent on the degree of differentiation of tumor cells. According to the literature has been retrieved, so far there is no domestic repressor bi  1 gene expression induces tumor cell apoptosis research reported in this study choose a different degree of differentiation of nasopharyngeal carcinoma cells with different metastatic potential of ovarian cancer Cell preliminary study.

    Plasmid vector constructed in this study can be bi  1 shRNA shRNA role of the enzyme in the cell can be formed quickly siRNA [10], it can be observed in different tumor cell RNAi effect on cell growth and expression in cells proliferation. In promoter role mU6, the recombinant plasmid shRNA expression in Figure 3 (list only recombinant plasmid expressing shRNA pmU6  bi  1  1 and other similar).

    The CNE  2Z and CNE  cells in our group experiments confirmed both bi  1 gene expression and the expression of the amount of the difference not statistically significant. Expression bi  1 shRNA plasmid transfected into CNE  2Z, CNE  1 cells, found for bi  different siRNA sequences CNE  2Z, CNE  1 cell growth and proliferation were strong inhibition. The statistical analysis showed that nasopharyngeal carcinoma cell growth and proliferation by inhibiting the bi  1 gene expression does not depend on the degree of differentiation of nasopharyngeal carcinoma cells, it initially speculated: repressor bi  1 gene expression using RNAi technology inhibition nose pharyngeal cancer cell growth and proliferation and induce cancer cell apoptosis in CNE  2Z and CNE  1 cell death (apoptosis) may be the same or similar to, the specific mechanism needs further study.

    Our group experiments confirmed HO8910PM and HO8910 cell bi  1 gene expression and the expression of the amount of the difference was not statistically significant. When bi  1 shRNA interference plasmid transfected to express to the HO8910PM and HO8910 cells, it is found that the growth of their HO8910PM proliferation had strong inhibition HO8910 cells, significantly inhibited the growth and proliferation. Tumor cell growth, proliferation, division and cell cycle regulation is closely related to some of the genes and their products, such as p53, p21, Cyclin D1, PCNA is important in the regulation of cell cycle regulatory factors [11]. HO8910PM and HO8910 cells in oncogenes and tumor suppressor genes, transfer genes and suppression of metastasis genes, apoptosis genes and survival gene expression differences [12]: HO8910PM cells of p21, Cyclin D1, expression of CD44V6, apoptosis connection gene 2 (ALG  2) [13], mutant p53, EGFR and other expression intensity greater than HO8910 cells; HO8910PM cells, nm23 Expression of p16 expression was weaker than HO8910 cells, two cells in the growth, proliferation and other process with the biological characteristics of each. Tumor occurrence and development of more than one gene is involved in a gene change affects only some of the biological characteristics of the tumor certain stage, after the results of the multi-stage synergy. Repressor bi  1 gene expression observed differences HO8910PM and HO8910 cell growth and proliferation, there are significant differences in protein expression in ovarian cancer cells in two different metastatic potential may specific mechanism remains to be further to study and explore.