Abstract Objective To investigate the adenovirus-mediated siRNA technology lowered the expression of c  Met overexpression of c  Met hepatoma cells grown in vitro and into nude mice. Adenovirus-mediated siRNA technology down the expression of c  Met; MTT assay and cell counting method to detect cell growth and proliferation by Western blot analysis of protein expression levels;; flow cytometry cell cycle changes situation; soft agar colony formation assay study cell colony formation ability. Results of adenovirus-mediated siRNA allows the cell c  Met in HCCLM3 the expression levels reduced by 90% or more. Down c  Met expression can HCCLM3 cell growth remain in the G1/G0 phase, proliferation rate decreased by 30% or more; lowered expression of c  Met enables HCCLM3 cell colony-forming ability decreased by approximately 78% (P <0.01). Conclusion adenovirus-mediated siRNA lowered the expression of c  Met with potential liver cancer gene therapeutic value.

Key words c  Met RNA interference recombinant adenovirus liver cancer

    c  Met is hepatocyte growth factor receptor overexpressed in a variety of tumors, is closely related to the occurrence and deterioration of the tumor [1]. And other scholars showed that c  Met over-expression in 30% to 50% of cases of liver cancer [2  4], 5-year survival rate of patients with liver cancer associated with high expression of c  Met was significantly lower than liver cancer with c  Met a little expression [4]. Human liver cells, over-expression of c  Met will lead to ligand-independent activation of c  Met and cell transformation [5].

    Although many experiments show that c  Met over-expression and the occurrence of liver cancer is closely related to the impact of the cell growth is unclear but lowered the expression of c  Met. RNA interference is emerging in recent years developed a suppressor gene expression technology, by its very nature is mediated by a length of 19 to 21 nucleotide small interfering RNA (small interfering RNA, siRNA) sequences are highly homologous The target gene mRNA degradation, which reduced the level of gene transcription (knock down) target gene expression [6]. Types of adenovirus vector infected cells, infection, high efficiency, high level of expression of foreign genes and is suitable both for in vitro and features suitable for in vivo studies are widely used in cancer gene therapy study [7]. We have detected by Western blot hepatoma cells in HCCLM3, c  Met high expression [2,3]. This article intends to make use of adenovirus-mediated siRNA technical visits down the expression of c  Met affect the the hepatoma cells HCCLM3 in vitro growth of.

    1 Materials and methods

    1.1 Materials and reagents

    Shuttle plasmid pShuttle  H1 donated by the German scholar Shen CX Reske SN benefit pAdEasy  adenovirus backbone plasmid provided by the American scholar, He TC. Fetal bovine serum Hangzhou Evergreen biotech companies products. Pac Ⅰ endonuclease NEB company’s products. Rabbit anti-human polyclonal antibody, c  Met Zymed company products in the United States. Cyclin D1, mouse anti-human monoclonal antibody for the company’s products in Santa Cruz. By rabbit anti-β-actin polyclonal antibody and AP-conjugated goat anti-rabbit secondary antibody was purchased from Wuhan Boster Biological Engineering Co., Ltd.. Methyl thiazolyl tetrazolium (MTT) were purchased from Sigma.

    1.2 Cell culture

    Hepatoma cells by HCCLM3 Shanghai Cancer Institute, kindly, at 37 ° C with 5% CO2 and saturated humidity CO2 incubator used cultured in DMEM medium containing 10% fetal bovine serum.

    1.3 recombinant adenovirus vector

    Retrieved from GenBank c  Met cDNA sequence (accession number: NM_000245), use of Ambion’s website (www.ambion.com/techlib/misc/ siRNA_finder.html) online tools (siRNA Target Finder) to identify potential of the target sequence, the general principles of the press siRNA design, select the target sequence. This experiment the selected target sequence is 5 ‘ AACATGGCTCTAGTTGTCGAC  3’ (Justice) located at the initiation codon downstream area 349 to 369. By Shen et al [7] provided the target sequence subcloned into pShuttle  H1 generate the pShuttle  H1  siRNA / met Referring He [8] the pShuttle  H1  siRNA / met with the virus backbone plasmid pAdEasy  1 homologous recombination in E. coli BJ5183 extract the recombinant virus plasmid transfected into 293A cells by Pac Ⅰ digested purified packaged recombinant adenovirus AdH1  siRNA / met, at the same time, using the same method to empty plasmid pShuttle  H1 constructed reorganization No-load adenovirus AdH1  null.

    Determination of the optimal multiplicity of infection of 1.4 recombinant adenovirus HCCLM3 cells

    We use the expression of the green fluorescent protein recombinant adenovirus AdCMV / GFP (the laboratory storage) to Determination of HCCLM3 cells optimal multiplicity of infection (multiplicity of infection, MOI). HCCLM3 cells seeded in 6-well plates, grown to 80% confluence, each well was added known virus concentration AdCMV / the the GFP virus liquid 0.1,0.2,0.3,0.5,1 and 2μl. Conventional culture after 48h, respectively in an inverted fluorescence microscope with visible light and fluorescence observation, stats cell percentage of the total number of cells expressing GFP (infection efficiency), and is calculated according to the hole of the added number of viruses corresponding MOI.

    1.5 Western blot analysis

    Cells infected with the virus 72h after suction removal of the medium, washed 2 times with ice cold PBS, lysis buffer solution (50.0 mmol / L Tris, 150.0 mmol / L NaCl, 0.1% SDS, 1.0% NP  40,1.0 mmol / L Na3VO4, 2.0 mmol / L NaF, 100.0 microg / mL PMSF in 1.0 μg / ml leupeptin and 1.0 μg / ml aprotinin), the ice bath was 30min, cells were scraped, 12 000G centrifuged 2min, the supernatant was collected. After protein quantification, taking 50μg of total protein in SDS  PAGE gel electrophoretic separation, transferred to a PVDF membrane by a conventional method, an anti-incubated overnight with 3% BSA for AP-labeled secondary antibody and NBT and BCIP Hin color.

    1.6 MTT assay of cell viability

    Take the logarithmic growth phase cells, digestion into single cell suspension were seeded in 96-well culture plate count after about 0.5 × 104 cells / well, located five wells. Cultured 18h, were added different MOI of virus solution (control wells set to without the virus processing unloaded virus). Culture was continued 72h, MTT was added to a final concentration of 0.5mg/ml, and incubated for 4h, the reaction was terminated, and DMSO was added to dissolve crystalline ELX 800 (Bio-Rad company), the absorbance at 490nm measured at OD value.

    1.7 cell growth curve determination

    Take logarithmic phase cells, digestion into single cell suspension were seeded in 24-well culture plate after count, about 5.0 × 104 cells / well, located three wells. The culture 18h, adding different MOI virus solution (control well is set to without the virus processors airborne virus). Digested every 24h counts, each count of 3 hole, calculate the mean. Total number of 5d, incubation time on the horizontal axis, the number of cells for the vertical axis, the cell growth curve.

    1.8 Flow cytometric analysis of cell cycle

    HCCLM3 cells infected with adenovirus 3D or 5d (control group is set to plus virus processing unloaded virus), the trypsinized cells were collected, and washed 2 times with PBS, fixed with 75% ethanol, the ice bath was 24h, and containing 1% BSA of PBS Mix thoroughly washed 2 times, resuspended in PBS and the cell concentration reached about 1.0 × 106/ml, and PI staining after flow cytometry analysis.

    1.9 soft agar colony formation in the experimental cells infected with adenovirus 24 h after trypsinization, serial dilutions take 2,000 cells, vaccination in containing underlying 6g / L agarose and top-level 4 g / L agarose soft agar 6-well plates 50μm的克隆。">continue to foster 15d observed under an inverted phase contrast microscope, count diameter> 50μm cloning.

    1.10 Statistical Methods

    Application SPSS10.0 statistical software for univariate analysis of variance and significant difference test.

    2 Results

    Optimal MOI 2.1 recombinant adenovirus of HCCLM3 cells

    In order to eliminate the toxic effects of the recombinant adenovirus itself on the cells, we first used the expression of the green fluorescent protein of adenovirus AdCMV / GFP to Determination of HCCLM3 cells optimal MOI of Figure 1. With the increase of the multiplicity of infection, the infection efficiency rising final adenovirus infection of cells efficiency can be more than 90%. Experiments, taken infection efficiency as high as possible and MOI as small as possible, without obvious cytotoxic phenomenon caused by the virus itself (as the optimal MOI of deformation or Piaoqi MOI) when cells. This article the recombinant adenoviruses the optimal MOI of HCCLM3 cells as 150.

    Figure 1 recombinant adenovirus HCCLM3 cells optimal MOI Determination

    2.2 AdH1  siRNA / met for HCCLM3 cell c  Met expression

    Down the expression of c  Met, we constructed a recombinant adenovirus AdH1  siRNA expression for c  Met siRNA / met and no-load adenovirus AdH1  null. Western blot analysis showed that with increasing MOI’s, AdH1  null does not affect the expression of c  Met inhibition AdH1  siRNA / met on the expression of c  Met gradually increased. By the optical density analysis, when MOI of 150, c  Met expression decreased more than 90%, as shown in Figure 2. C  Met presents two bands, the larger strip molecular weight of 170KD genus c  Met precursor form; smaller stripe molecular weight of 140 kD, a mature form of the β subunit of the c  Met [ 1].

    2.3 different MOI AdH1  siRNA / met for HCCLM3 cell vitality impact

    3d after the infected cells, the the unloaded adenovirus AdH1  null of HCCLM3 cells vitality had no significant effect, while adenovirus AdH1  siRNA / met inhibit HCCLM3 cell vitality, and inhibition gradually enhanced with the increase of MOI. When the MOI is greater than 50, the inhibitory effect was significant (P <0.01). MOI equal to 150, the adenoviral Adh1  siRNA / met of HCCLM3 cell viability inhibition rate of approximately 38% (P <0.01), see Figure 3.

    2.4 AdH1  siRNA / met to suppress HCCLM3 cell proliferation

    Cell counting method showed no significant impact, the AdH1  null of HCCLM3 cell proliferation, and AdH1  siRNA / met HCCLM3 cell proliferation inhibition. In AdH1  siRNA / met infection HCCLM3 cell 3d, 4d and 5d, cell proliferation rate decreased by 28%, 35% and 38% (P <0.01), shown in Figure 4.

    2.5 AdH1  siRNA / met HCCLM3 cells remain in the G0/G1 phase

    In order to understand the AdH1  siRNA / met suppression the HCCLM3 cell growth and proliferation mechanism, we detected by flow cytometry AdH1  siRNA / met infected cells 3d and 5d after HCCLM3 cell cycle changes. Infected 3d, the proportion of the blank control group and the no-load the control group HCCLM3 cells in G1/G0 phase cells were 51.99% and 54.16%, respectively, while the experimental group HCCLM3 cells in G1/G0 phase was increased to 68.48%; experiment groups in the proportion of cells in S phase was only 22.56%, 37.11% and 35.44%, significantly lower than the control group and the no-load control group. As infected with the virus time to extend 5d, the experimental group, the proportion of cells in G1/G0 phase further increased to 84.98%, 61.50% and 64.94%, significantly higher than the control group and the no-load control group; S phase cells ratio further decreased to 12.12%, 29.04% and 25.21%, significantly lower than the control group and the no-load control group. 3d and 5d are not detected apoptosis.

    2.6 AdH1  siRNA / met significantly inhibit HCCLM3 cell clones to form

    Soft agar colony forming ability to reflect the tumorigenicity of the cells in vitro, we investigated this experiment the AdH1  siRNA / met the HCCLM3 cell colony formation ability, as shown in Figure 5. No significant impact on the number of clones per field blank control group, no-load control group and the experimental group (79.4 ± 10.7) (73.0 ± 9.9) and (16.0 ± 8.7), AdH1  null of HCCLM3 cell colony formation ability , and AdH1  siRNA / met HCCLM3 cell colony forming ability decreased by approximately 78% (P <0.01).

    3 Discussion

    c  Met with a variety of tumor development are closely related, has been a concern for cancer gene therapy target genes. The people have been taken by a variety of strategies to cut the tumor cells, the expression of c  Met for the treatment of tumors. Abounader [9] down by use U1snRNA ribozyme inhibition of c  Met expression of the phenotype of malignant glioma reversal of growth arrest or apoptosis; Herynk [10] by adenovirus vector-mediated ribozyme c  Met expression and inhibits the growth of colon cancer in the liver. In these experiments, the expression of c  Met has been lowered from 30% to 90% range. RNA interference technology is an efficient, stable and easy to operate features, Shinomiya et al [11] found down the expression of c  Met adenovirus-mediated siRNA technology can inhibit a variety of tumor cell growth in vitro and in vivo tumorigenicity their results showed that adenovirus-mediated siRNA technology allows the expression of c  Met declined by 62% to 100%, not lowered the efficiency of different cell. Hepatoma cells in their study, our results suggest that adenovirus-mediated siRNA technology can effectively cut hepatoma cell c  Met expression, c  Met expression is down more than 90% increase in the multiplicity of infection with the virus. Herynk [10] studies have shown that the expression of c  Met decline of about 30% is sufficient to inhibit colon cancer cells in the liver tumor. Our in vitro experiments showed that AdH1  siRNA / met inhibit hepatoma cell growth HCCLM3, when virus infection (MOI) of 50 and gradually increased with the increase in inhibition of virus infection (MOI), inhibition very significant, the expression levels of c  Met a decrease of approximately 50%.

    Persistent activation of oncogenes is necessary for tumor growth [12,13]. Cancer gene inactivation of the tumor cells will be at least three possible situations: First, the tumor cells may be differentiated into normal cells. Shachaf et al [13] found that the myc gene expression inhibition of liver cancer cells, part of the cancer cells differentiated into hepatocytes, part transformed into liver stem cells; most oncogene is a mitogen, their inactivation may will lead to the stagnation of the growth of tumor cells; Third, tumor cells may apoptosis. Our experiments show that adenovirus-mediated siRNA technology lowered the expression of c  Met can inhibit the growth of liver cancer cells, consistent with the second scenario. Shinomiya et al [11] reported that the RNAi technology inhibition of Met expression allows a variety of tumor cell apoptosis. Not detected by flow cytometry AdH1  siRNA / met after infection HCCLM3 apoptosis was not observed under the microscope to the morphology of apoptotic cells were detected by TUNEL technique, also not observed apoptosis the cells, which may be different cell types. Has been reported [14] that Met and Fas on the cell membrane in direct contact, exists in the form of a composite body, Met and Fas after separation, the cells may be due to a FasL / Fas pathway activation and initiate apoptosis. Previous the experiments show HCCLM3 cells Fas expression [2], speak thus from this point down the expression of c  Met HCCLM3 cells apoptosis is understandable.

    Huh et al [15] conditional gene knockout studies found that and c  met under normal physiological conditions knockout non-lethal effects on the liver cells. Our previous studies have shown [3], adenovirus AdH1  siRNA / met on the growth of normal liver cells LO2 no significant impact, only the expression of c  Met BEL7402 considerable LO2 cells the line SMMC7721. HepG2 cells growth rate decreased by 8% to 10%, but allows the high expression of c  Met MHCC97  L cell growth rate decreased by 30% or more. The results of this paper shows the in vitro growth and tumorigenicity ability the down c  Met expression HCCLM3 cells also significantly inhibited further showed that adenovirus-mediated siRNA technology lowered c  Met expression inhibits c  Met high expression the growth of liver cancer cells, with the potential liver cancer gene therapeutic value.